ID: 1020278072

View in Genome Browser
Species Human (GRCh38)
Location 7:6636858-6636880
Sequence CACAAGACGTTCACCCCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020278056_1020278072 19 Left 1020278056 7:6636816-6636838 CCATAAGACGTTCACCCCGCCCG No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278055_1020278072 20 Left 1020278055 7:6636815-6636837 CCCATAAGACGTTCACCCCGCCC No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278060_1020278072 0 Left 1020278060 7:6636835-6636857 CCCGTCCCTCCTCCCTCCCCACC No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278059_1020278072 3 Left 1020278059 7:6636832-6636854 CCGCCCGTCCCTCCTCCCTCCCC No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278053_1020278072 30 Left 1020278053 7:6636805-6636827 CCACAGTCCACCCATAAGACGTT No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278063_1020278072 -6 Left 1020278063 7:6636841-6636863 CCTCCTCCCTCCCCACCCACAAG No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278061_1020278072 -1 Left 1020278061 7:6636836-6636858 CCGTCCCTCCTCCCTCCCCACCC No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278054_1020278072 23 Left 1020278054 7:6636812-6636834 CCACCCATAAGACGTTCACCCCG No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278057_1020278072 5 Left 1020278057 7:6636830-6636852 CCCCGCCCGTCCCTCCTCCCTCC No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278058_1020278072 4 Left 1020278058 7:6636831-6636853 CCCGCCCGTCCCTCCTCCCTCCC No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278064_1020278072 -9 Left 1020278064 7:6636844-6636866 CCTCCCTCCCCACCCACAAGACG No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data
1020278062_1020278072 -5 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278072 7:6636858-6636880 CACAAGACGTTCACCCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020278072 Original CRISPR CACAAGACGTTCACCCCGCG CGG Intergenic
No off target data available for this crispr