ID: 1020278086

View in Genome Browser
Species Human (GRCh38)
Location 7:6636891-6636913
Sequence CTGGTGGAGGCGTGGACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020278068_1020278086 16 Left 1020278068 7:6636852-6636874 CCCACCCACAAGACGTTCACCCC No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278066_1020278086 20 Left 1020278066 7:6636848-6636870 CCTCCCCACCCACAAGACGTTCA No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278065_1020278086 21 Left 1020278065 7:6636847-6636869 CCCTCCCCACCCACAAGACGTTC No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278062_1020278086 28 Left 1020278062 7:6636840-6636862 CCCTCCTCCCTCCCCACCCACAA No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278067_1020278086 17 Left 1020278067 7:6636851-6636873 CCCCACCCACAAGACGTTCACCC No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278080_1020278086 -5 Left 1020278080 7:6636873-6636895 CCGCGCGGGCCCGGGGATCTGGT No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278064_1020278086 24 Left 1020278064 7:6636844-6636866 CCTCCCTCCCCACCCACAAGACG No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278077_1020278086 -3 Left 1020278077 7:6636871-6636893 CCCCGCGCGGGCCCGGGGATCTG No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278063_1020278086 27 Left 1020278063 7:6636841-6636863 CCTCCTCCCTCCCCACCCACAAG No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278070_1020278086 12 Left 1020278070 7:6636856-6636878 CCCACAAGACGTTCACCCCGCGC No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278071_1020278086 11 Left 1020278071 7:6636857-6636879 CCACAAGACGTTCACCCCGCGCG No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278069_1020278086 15 Left 1020278069 7:6636853-6636875 CCACCCACAAGACGTTCACCCCG No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data
1020278078_1020278086 -4 Left 1020278078 7:6636872-6636894 CCCGCGCGGGCCCGGGGATCTGG No data
Right 1020278086 7:6636891-6636913 CTGGTGGAGGCGTGGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020278086 Original CRISPR CTGGTGGAGGCGTGGACACC TGG Intergenic
No off target data available for this crispr