ID: 1020279673

View in Genome Browser
Species Human (GRCh38)
Location 7:6643890-6643912
Sequence CTTCCTGGTAGAGGCCCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020279673_1020279681 19 Left 1020279673 7:6643890-6643912 CCAGCGGGGCCTCTACCAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1020279681 7:6643932-6643954 GATTCTCGTGTCCTTGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 82
1020279673_1020279680 14 Left 1020279673 7:6643890-6643912 CCAGCGGGGCCTCTACCAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1020279680 7:6643927-6643949 TATGGGATTCTCGTGTCCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1020279673_1020279678 -3 Left 1020279673 7:6643890-6643912 CCAGCGGGGCCTCTACCAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1020279678 7:6643910-6643932 AAGTCATGCAGGAGAACTATGGG 0: 1
1: 0
2: 0
3: 24
4: 159
1020279673_1020279682 23 Left 1020279673 7:6643890-6643912 CCAGCGGGGCCTCTACCAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1020279682 7:6643936-6643958 CTCGTGTCCTTGGGTAAGGACGG 0: 1
1: 0
2: 0
3: 11
4: 117
1020279673_1020279679 13 Left 1020279673 7:6643890-6643912 CCAGCGGGGCCTCTACCAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1020279679 7:6643926-6643948 CTATGGGATTCTCGTGTCCTTGG 0: 1
1: 0
2: 0
3: 4
4: 70
1020279673_1020279683 24 Left 1020279673 7:6643890-6643912 CCAGCGGGGCCTCTACCAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1020279683 7:6643937-6643959 TCGTGTCCTTGGGTAAGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1020279673_1020279677 -4 Left 1020279673 7:6643890-6643912 CCAGCGGGGCCTCTACCAGGAAG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1020279677 7:6643909-6643931 GAAGTCATGCAGGAGAACTATGG 0: 1
1: 0
2: 3
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020279673 Original CRISPR CTTCCTGGTAGAGGCCCCGC TGG (reversed) Exonic
903011795 1:20336460-20336482 CTTGGTGGTAGAGTCTCCGCTGG - Exonic
905404903 1:37726073-37726095 CTTCCGGGCAGAGGCTCTGCAGG - Intronic
907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG + Intergenic
911073453 1:93850376-93850398 CTTGGTGGTAGTGGTCCCGCAGG - Intergenic
913969858 1:143406508-143406530 CTCCCTGGTAGAGCCACAGCGGG - Intergenic
914064232 1:144232102-144232124 CTCCCTGGTAGAGCCACAGCGGG - Intergenic
914114918 1:144734252-144734274 CTCCCTGGTAGAGCCACAGCGGG + Intergenic
914197314 1:145454372-145454394 ATTGCTTGTAGAGGACCCGCTGG + Intergenic
915191542 1:154154855-154154877 TTTCCTGCTGGAGGCCCAGCGGG - Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
917683417 1:177391590-177391612 CTTCCTTGTTGGGGCCCTGCTGG - Intergenic
919991028 1:202708993-202709015 CCACCTGGGAGAGGCCCCGCAGG + Intronic
920263299 1:204704140-204704162 CTTTCTGCTCCAGGCCCCGCAGG + Intergenic
922755820 1:228096473-228096495 CTTCCTGCTGGAGTCTCCGCAGG + Intronic
924706403 1:246506604-246506626 CTCCCCTGCAGAGGCCCCGCCGG - Intronic
1064622540 10:17229857-17229879 CCTCCTCGTAGAGGTCCCCCAGG - Exonic
1066985718 10:42464885-42464907 GTTGCTGGTAGAGGCCCAGAAGG - Intergenic
1067429801 10:46235643-46235665 CTTCCTGGAGGAGGCCACTCTGG - Intergenic
1067443842 10:46328176-46328198 CTTCCTGGAGGAGGCCACTCTGG + Intronic
1071761754 10:88616259-88616281 TTTCCTGTTAGTGACCCCGCGGG + Intergenic
1075082515 10:119393325-119393347 CCTCCCGGCAGAGGCCCCGCCGG - Intronic
1076476610 10:130758074-130758096 CTTCGTGCTTGAGGCCACGCAGG - Intergenic
1076864466 10:133160202-133160224 CTTCCTGGGGGAGGCACCGGGGG - Intergenic
1077139938 11:1019822-1019844 CTGCCTGGCAGAGGCCCTGCAGG + Intronic
1077487825 11:2847160-2847182 CCTCCTGGAAGTGGCCCAGCAGG + Intronic
1078063191 11:8061417-8061439 TTTCCCTGTAGAGGCACCGCAGG - Intronic
1081617820 11:44601033-44601055 CTTCCTGGAGGAGGCCGAGCAGG - Intronic
1083829074 11:65219588-65219610 CTGCCAGGCAGAGGCCCTGCAGG + Intergenic
1085743446 11:79095610-79095632 CTTCCAGTTTGAGGCCCCTCTGG + Intronic
1089152024 11:116371706-116371728 CATCCTGGAAGATGCCCCGTAGG + Intergenic
1089566170 11:119372916-119372938 CTGTCTGGTAGAGCCCCTGCAGG + Exonic
1089770082 11:120796557-120796579 CTTCCTGGAAGAGGCGCCTGAGG + Intronic
1094352933 12:29546469-29546491 CTTCCTGGGACAGACCCTGCAGG + Intronic
1097130355 12:56806737-56806759 CTTCCTGGTAGGAGCCACGTTGG - Intergenic
1101359311 12:104011046-104011068 CTACCTGGCAGAGGCCCCTAAGG - Intronic
1101898228 12:108771384-108771406 CTTCCTGGAAGAGGCAGCTCTGG + Intergenic
1104001763 12:124864424-124864446 GTCCCTGGAAGAAGCCCCGCAGG + Intronic
1108312518 13:49209952-49209974 CTTCCTGGTAGTGGCACTGCTGG + Intergenic
1113566975 13:111325099-111325121 CTTCCTGGGAGAAGCCACCCTGG - Intronic
1117524044 14:56579785-56579807 CTTCCGGGTCGAGCCTCCGCGGG - Exonic
1118806014 14:69237556-69237578 CTTCCTGGAACAAGCCCAGCCGG - Exonic
1121444581 14:93970413-93970435 CTTCCTGGTAGAGGAGATGCTGG - Intronic
1122773202 14:104106255-104106277 GGTCCTGGCAGAGGCCCCACAGG - Intronic
1122773216 14:104106294-104106316 GGTCCTGGCAGAGGCCCCACAGG - Intronic
1124212071 15:27771352-27771374 CTGCCTGCGAGAGGCCCCGGGGG + Intronic
1126911118 15:53418141-53418163 CTTCCTGGGAGAGGGCCCCCAGG + Intergenic
1130093230 15:80838287-80838309 CTTCCTGGCAGGGACCCTGCTGG + Intronic
1133258264 16:4531974-4531996 CCCCCTGCTAGAGGCCCAGCGGG - Intronic
1136466263 16:30445869-30445891 CTTCCTGATAGAGGAGCCGCCGG + Exonic
1136538292 16:30913389-30913411 CTGCCTGGCACAGGCCCTGCCGG - Intergenic
1137038874 16:35591609-35591631 CTTCGTGGTAGTGGTCCCCCAGG + Intergenic
1140457545 16:75113912-75113934 CTCCCTGGAAGAGGCCCCCTGGG - Intronic
1140639965 16:76960189-76960211 CTTCCACGAAGAGGCCCTGCAGG - Intergenic
1141660034 16:85436739-85436761 CTGCCTGGCAGAGTCCCCGCTGG + Intergenic
1142018613 16:87766023-87766045 CTTCCGGGTAGAGGTGCGGCTGG + Intergenic
1142411225 16:89918206-89918228 CTTCCTGGGAGCGGACCGGCTGG - Exonic
1142434450 16:90047689-90047711 CTTCCTGGGCAAAGCCCCGCTGG - Intergenic
1143371780 17:6444903-6444925 CTTCCTGGAAGAGGGGCCTCGGG - Intronic
1143660039 17:8319043-8319065 CTCCCTGGTCCAGGCCCAGCAGG + Exonic
1144672348 17:17139999-17140021 CTTCCTGGCTAAGGCCCCACTGG - Intronic
1145998462 17:29117699-29117721 CTTCCTGACAGAGGCCCCCGAGG - Intronic
1146475936 17:33162807-33162829 CTTCCTGGTAGCAGCTCCCCTGG + Intronic
1151054197 17:71012864-71012886 CTTCCTGGTGGAGGCCATGGGGG + Intergenic
1152720775 17:81922952-81922974 CCTCCTTGGACAGGCCCCGCAGG + Exonic
1153764228 18:8360042-8360064 CCTCCTGGGAGAGGCCCCAGTGG - Intronic
1155123078 18:22842547-22842569 ATTCATGATAGAGGCCCCACAGG + Intronic
1157413697 18:47485015-47485037 CTTCCAGGTGGAGGGCCGGCAGG + Intergenic
1158548389 18:58414964-58414986 CTTCCTTGGAGAGGCCCCGGAGG + Intergenic
1160889747 19:1370985-1371007 CCTCCTGGTAGACGCCCTGCAGG - Exonic
1161288463 19:3480397-3480419 CTCCCCGGTGGAGGCCCAGCAGG - Exonic
1163847111 19:19643909-19643931 GCTCCTGGGAGAGGCCCCCCGGG - Intergenic
1164571396 19:29377132-29377154 CATCCTGGCAGAGACCCAGCAGG + Intergenic
1166846253 19:45730552-45730574 CATCCAGGTAGAGGCCCTGAAGG - Intronic
1168450535 19:56462982-56463004 ATTCCAGGTAGAGGCACAGCAGG + Intronic
925095261 2:1193329-1193351 CTCCCTCCTAGAGGCTCCGCAGG + Intronic
925340082 2:3130172-3130194 CTTCCTTCTAGAGGCCCTGGGGG + Intergenic
931748864 2:65313773-65313795 CGTCCTGGCAGTGGCCCCGGCGG + Exonic
932667402 2:73708370-73708392 CTTCTTGGTGGAGGCCCAGTTGG - Intergenic
932670014 2:73728873-73728895 CTTCCTGGCAGAGGCCCAAGTGG - Intergenic
934174550 2:89567421-89567443 CTCCCTGGTAGAGCCACAGCGGG - Intergenic
934284866 2:91641771-91641793 CTCCCTGGTAGAGCCACAGCGGG - Intergenic
936241221 2:110790213-110790235 CTTCCAGGTAGTGGCTCCGTTGG + Intronic
936469120 2:112782423-112782445 CATCCTGAGAAAGGCCCCGCAGG - Intronic
938131392 2:128718496-128718518 CTTCCTGGCAGAGTGCCCGGCGG - Intergenic
942699369 2:178686975-178686997 CTTCCTGGAAGAGGCCATGATGG - Intronic
947596156 2:231412871-231412893 TTCCCTGGTAGAGGCCCCTAAGG - Intergenic
948789569 2:240370327-240370349 ATTCCGGGTAGAGGCCCAGCAGG - Intergenic
949052563 2:241904968-241904990 CTTCCAGGAGGAGGCCCCGAGGG - Intergenic
1174387554 20:50196350-50196372 CTTCCTAGGAGGGGCCTCGCAGG - Intergenic
1175763111 20:61574318-61574340 GTGCTTGGTAGAGGCCCCGTGGG + Intronic
1175895023 20:62332356-62332378 CTTCCTGGTAAGGACCCCTCAGG - Exonic
1176008547 20:62879904-62879926 CTTCCAGGGCCAGGCCCCGCAGG - Exonic
1182321512 22:29480949-29480971 CTTCCTGGTGGTGGCGCCGCAGG - Exonic
1182729384 22:32474965-32474987 CTTCCGGGTCCAGGCCCCTCGGG + Exonic
1183069568 22:35386821-35386843 CCTTCTGGTACGGGCCCCGCTGG + Exonic
1184951738 22:47847946-47847968 CTTCCTGGAAGAAGCCACGTGGG + Intergenic
953475175 3:43199763-43199785 CTTCCTTGGAGAAGCCTCGCTGG + Intergenic
954540186 3:51388475-51388497 CTTCCTGGTACAGGTCCAGTTGG + Intronic
954752909 3:52823726-52823748 CTTCCTGGTAGAAGTCCTGCAGG + Exonic
955000218 3:54920629-54920651 CTTCCTGGCAGAGGCTCCTATGG - Intronic
961359817 3:126360155-126360177 CTTCCTGGAAGAGGGCAGGCTGG - Intergenic
961549334 3:127659936-127659958 CTTCTTGGTGGAGTCCCCGAAGG - Intronic
962815360 3:138992576-138992598 CTTCTTAGTAGAGGGCCCTCGGG + Intergenic
962894526 3:139702157-139702179 CTTCCTGGAAGAGGGACCCCAGG - Intergenic
968434153 4:576323-576345 CCTCCTGGGAGGGGCCCCGCGGG - Intergenic
968481638 4:835615-835637 CTTCCTGGCAGTGGCACAGCCGG - Intergenic
969529962 4:7725158-7725180 CCTCCAGGTAGAGGGCCTGCAGG - Exonic
970450961 4:16166134-16166156 CTCCCAGGCAGAGGCCCGGCAGG - Intronic
971935184 4:33138520-33138542 CTTACTGATAGAGGCCAGGCTGG - Intergenic
978761396 4:112358566-112358588 CTGCCTGGCAGAGGCCCTGGGGG + Intronic
980844938 4:138312920-138312942 CATCCTGGTAGTGTCCCAGCTGG + Intergenic
983126046 4:163951425-163951447 CTTCCTGGTAGAGGATACACAGG + Intronic
986711798 5:10493154-10493176 CTTCCTGGTTCAGCCCCGGCAGG + Intergenic
990553714 5:56909617-56909639 CGTCCTGGTCACGGCCCCGCGGG + Exonic
997303840 5:132824667-132824689 GTTCCTAGAAGAGGCCCCACTGG - Exonic
1005831664 6:29675969-29675991 CATCCTGGTAAAGGACCCTCTGG + Exonic
1006408151 6:33856968-33856990 GGTCCTGGTAGATGCCCCACAGG + Intergenic
1007369450 6:41416739-41416761 GGTCCTGGTTGAGGCACCGCAGG - Intergenic
1007605081 6:43112191-43112213 CATCCTTGTAGAGGCTCTGCAGG + Intronic
1016290347 6:142522173-142522195 GTTCCTTCTAGAGGCCCCGAGGG - Intergenic
1019705951 7:2497514-2497536 CTTCTGGGTAGAGGCCAGGCTGG - Intergenic
1019795032 7:3043081-3043103 CTTTCTAGTACAGTCCCCGCGGG + Intronic
1019812879 7:3177320-3177342 ATTCCTGGTAGAGGAACCACAGG - Intergenic
1019917719 7:4144256-4144278 CTTCCTGGATGTGGCCCTGCTGG - Intronic
1020137500 7:5595017-5595039 CTTGCAGACAGAGGCCCCGCTGG + Intronic
1020279673 7:6643890-6643912 CTTCCTGGTAGAGGCCCCGCTGG - Exonic
1022893852 7:34729094-34729116 CTTCCTGGGAGAGGCTCAGAAGG - Intronic
1024991174 7:55235464-55235486 CTTCCCGCTAGAGCCACCGCAGG - Intronic
1026903770 7:74051249-74051271 CCTCCCAGTGGAGGCCCCGCAGG + Intronic
1034417233 7:150971564-150971586 CTTCCAGATAGAGGCTCCGAGGG + Intronic
1034938739 7:155216442-155216464 ATTCCTGGTGAAGGCCCCGTGGG + Intergenic
1037401248 8:18497240-18497262 CCTACTGGTAGTGGCACCGCTGG + Intergenic
1039712249 8:40067550-40067572 CATCATGTTAGAGCCCCCGCAGG + Intergenic
1046413818 8:113884285-113884307 CTTGGTGGTAGTGGTCCCGCGGG - Intergenic
1047203087 8:122782429-122782451 CGTCCCGGTGGAGTCCCCGCGGG - Intronic
1049213902 8:141399046-141399068 CTTCCTGGAAGAGGCTCGGGAGG + Intronic
1049239119 8:141528006-141528028 CATCTTGGGAGAGGCCCAGCGGG - Intergenic
1049252209 8:141595388-141595410 CTCCCTAGAAGAGGCCCCTCAGG + Intergenic
1049636259 8:143691141-143691163 CGTCCCGGTAGAGGGCCCTCTGG - Exonic
1049708792 8:144054564-144054586 CCTCCTGGAAGACGCCCCCCTGG + Exonic
1049850895 8:144829546-144829568 CTTCCCTGTAGAGGGCCCTCTGG - Exonic
1057618868 9:96618579-96618601 CTTCCTTCTCGAGGCCCCGGCGG + Intronic
1061752834 9:132792668-132792690 GTGCCTGGTCGAGGTCCCGCGGG + Exonic
1062590506 9:137272488-137272510 CTTCCTGGAAAAGGCCGTGCAGG - Exonic
1062696369 9:137878053-137878075 ATTGCTTGTAGAGGACCCGCTGG - Exonic
1196444282 X:115737317-115737339 CTCCCTGGCGGAGGCTCCGCTGG + Intergenic
1198296034 X:135287588-135287610 CTTCATGGGAAAGGCCCCACAGG - Exonic
1199612685 X:149631553-149631575 AGTCCTGGAAGAGGCCCCTCAGG + Exonic
1199723776 X:150562749-150562771 CCTCCTTGAGGAGGCCCCGCTGG - Intergenic
1202046514 Y:20741389-20741411 CTTGCTGGCAGAGGCCCGGTGGG - Intergenic