ID: 1020279771

View in Genome Browser
Species Human (GRCh38)
Location 7:6644256-6644278
Sequence CTTGCAGGTGAAGGTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020279756_1020279771 25 Left 1020279756 7:6644208-6644230 CCTCCAGGGGTGAGGCGGAAGGC 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1020279771 7:6644256-6644278 CTTGCAGGTGAAGGTGTTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 297
1020279757_1020279771 22 Left 1020279757 7:6644211-6644233 CCAGGGGTGAGGCGGAAGGCGAG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1020279771 7:6644256-6644278 CTTGCAGGTGAAGGTGTTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020279771 Original CRISPR CTTGCAGGTGAAGGTGTTGG GGG Intronic
900576410 1:3384721-3384743 TCTGAAGGTGAAGGTGTTGCTGG - Intronic
900940009 1:5792622-5792644 CTTGCAGGTGCAGCACTTGGTGG - Intergenic
901625450 1:10622124-10622146 CTTGGAGGTGAGGGTGTGGAGGG - Intronic
901816466 1:11796325-11796347 CTTGAAGGAGAAGGTGTCTGCGG - Exonic
901823881 1:11847975-11847997 CTTGCAGCTGAGGGTCTGGGGGG - Intronic
902239299 1:15077670-15077692 CCTTCAGGTGAAGATGTTGATGG + Intronic
902714140 1:18260899-18260921 TTTCCACGTGGAGGTGTTGGGGG + Intronic
902743088 1:18453784-18453806 CTGGCAGGTGAAGGTGGATGTGG - Intergenic
905540121 1:38753981-38754003 CTTGCAGTGGAAGGTGAAGGGGG - Intergenic
907644303 1:56226429-56226451 CTTGCAAGTGAAGGTTTTCTAGG + Intergenic
907822811 1:57987763-57987785 TTTGCTGGTGAAGGAGTTGGGGG + Intronic
908704074 1:66931032-66931054 CTGGAAAGTGAAGGTGGTGGGGG - Intronic
908807701 1:67948044-67948066 CTTCCAGGTGATGGTGGAGGCGG - Intergenic
910125481 1:83837433-83837455 CTTGCAGGTGATGCTAATGGGGG - Intergenic
912500761 1:110120586-110120608 GGTGCCGGTGATGGTGTTGGTGG - Intergenic
916547052 1:165815793-165815815 CTTGTAAGTGAAGGTCTTTGAGG - Intronic
917032576 1:170710203-170710225 TTTGGTGGTGATGGTGTTGGTGG - Intronic
917180453 1:172290951-172290973 CCTGGAGGAGAAGGTGTTTGAGG + Intronic
917486401 1:175458951-175458973 CGTGGTGGTGATGGTGTTGGTGG - Intronic
917634510 1:176921856-176921878 GTTGCAGGGGAGGGTGTTTGGGG + Intronic
918537886 1:185594558-185594580 CCTGAAGGTGAAGGGGTTGAAGG + Intergenic
920032972 1:203048436-203048458 CTGGCAGGTGAAGGGGGAGGTGG + Intronic
921973438 1:221175828-221175850 CTTGCAGGTGTATGTGTATGTGG + Intergenic
924680211 1:246223311-246223333 CTTGCTGATGAAGGGGATGGTGG + Intronic
1062960522 10:1570380-1570402 CTCGCAGGTGCAGGTGCTGGGGG - Intronic
1063149161 10:3321190-3321212 CTTTCTGGAGAAGGTGGTGGTGG + Intergenic
1063777079 10:9275371-9275393 ATTTCAGGAGAAGGTGGTGGTGG - Intergenic
1063980650 10:11449137-11449159 CTTGAAGGTGGAGGGTTTGGGGG - Intergenic
1066028492 10:31391333-31391355 CTTTCAGGTGACTGTTTTGGGGG - Intronic
1066153148 10:32646596-32646618 CTTTCAGATAAAGGTGTGGGGGG + Intronic
1068900823 10:62268229-62268251 TTTGCAGGTGTAGGTGATGCCGG - Intronic
1071156526 10:82695885-82695907 CTTGCAGGTAAAGGTTTTAAGGG - Intronic
1071532464 10:86400616-86400638 CTGGAAGGTGAGGGTGTGGGAGG - Intergenic
1072726497 10:97817101-97817123 ATTGCAGGTGAAGGAGAGGGTGG + Intergenic
1073487693 10:103830553-103830575 TTTGCAGTAGAGGGTGTTGGAGG + Intronic
1073606149 10:104897746-104897768 CTTGCAAGTGAAGCAGTTGTTGG + Intronic
1073773058 10:106756466-106756488 CTTGCAGGTCAAGGGGTTCAAGG - Intronic
1076006547 10:126952283-126952305 ATTGTAGGTGATGGTGGTGGTGG + Intronic
1076506711 10:130979945-130979967 CTTGGTGGTGAAGTTGTTAGGGG + Intergenic
1076634873 10:131875597-131875619 GAAGCAGCTGAAGGTGTTGGGGG - Intergenic
1077049887 11:561789-561811 CATGGAGCTGAAGGTGTGGGTGG + Exonic
1077915180 11:6607015-6607037 CGTACAGCTGAAGGGGTTGGGGG - Intronic
1078106155 11:8359294-8359316 GTTGAAGGAGAAGGTGTTGAGGG + Intergenic
1078636533 11:13055475-13055497 TTGGGAGGTGAAGGTGGTGGGGG + Intergenic
1079170447 11:18089484-18089506 CTTGCTGGTGAAGGTGGGGGAGG - Exonic
1079695219 11:23474173-23474195 CTTGTAGGTAAGGGTGTTGGGGG + Intergenic
1079964513 11:26964772-26964794 GTTGCGTCTGAAGGTGTTGGAGG + Intergenic
1081668933 11:44932706-44932728 CCTGCAGGTGAGGGTGAGGGAGG - Exonic
1082225972 11:49707216-49707238 CATGCATGTGTATGTGTTGGTGG - Intergenic
1084784539 11:71434567-71434589 CTCGCTGGAGAAGGTGTGGGAGG + Exonic
1084932912 11:72571172-72571194 CAGGCAGGTGAAGGAGTTGAAGG - Intergenic
1085322646 11:75584080-75584102 CTTGCAAATGAAGATGTTGAGGG + Intergenic
1085914441 11:80868324-80868346 CTGGGTGGTGAAGGTGTTGGTGG - Intergenic
1086623122 11:88912524-88912546 CATGCATGTGTATGTGTTGGTGG + Intronic
1086891720 11:92266104-92266126 CTTGCAAGTCAAAGTCTTGGAGG - Intergenic
1087654628 11:100907506-100907528 CTTGCAGATGGGGGAGTTGGTGG + Intronic
1087952275 11:104237459-104237481 TTTGCAGGAGATGGAGTTGGGGG + Intergenic
1089080634 11:115773593-115773615 GGTGCAGGTGACGGTGCTGGGGG + Intergenic
1089125289 11:116172381-116172403 CTTGGGAGTGAAGGGGTTGGGGG + Intergenic
1089752323 11:120660538-120660560 CATGCAGGTGGTGGTGGTGGAGG + Intronic
1090350539 11:126105051-126105073 GGTGCAGGTGCTGGTGTTGGTGG - Intergenic
1091056198 11:132421180-132421202 CTTGCTGATAAAGGTGATGGAGG - Intronic
1093756826 12:22862268-22862290 CTTGGAGGAGATGGTGGTGGGGG + Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094344751 12:29454855-29454877 CTGTCTGGTGAAGGTGTGGGTGG + Exonic
1095409302 12:41904782-41904804 CTTGCAGGTGATGCTGATGCTGG + Intergenic
1096213020 12:49780822-49780844 ATGGCAGGAGAAGATGTTGGAGG - Intergenic
1099399747 12:82188370-82188392 ATAGCATGTGTAGGTGTTGGTGG - Intergenic
1101206921 12:102497723-102497745 CTAGCTGGTGCAGGGGTTGGGGG - Intergenic
1102260079 12:111438164-111438186 GTGGCAGGGGAAGGTGTGGGCGG + Intronic
1102417690 12:112778943-112778965 CTTTCAGGTGGAGGTTTGGGTGG - Intronic
1103727176 12:123003779-123003801 CCAGCAGGTGTAGGGGTTGGGGG - Intronic
1103946212 12:124528128-124528150 CTTGGTGGTGGAGGTGGTGGTGG - Intronic
1103975991 12:124703154-124703176 ATTTCAGGTGAAGCTCTTGGTGG + Intergenic
1104288861 12:127450018-127450040 CTTCCAGGTGGATGTGTTGGAGG - Intergenic
1104463861 12:128975033-128975055 TTTGCAGGTGCAGGTGCGGGGGG - Intronic
1104855518 12:131900670-131900692 CTTGCAGCTAAAGGTCTTGCTGG + Intronic
1105779725 13:23695783-23695805 TCTGCAGGAGAAGGTGCTGGCGG - Intergenic
1106850196 13:33781906-33781928 CTTGCAGGTGAACTTGAGGGTGG - Intergenic
1106864473 13:33948557-33948579 CATGCAGGGCAAGCTGTTGGTGG - Intronic
1107977637 13:45705190-45705212 CTTGCAAGTTAATGTGCTGGAGG - Intronic
1107986945 13:45783913-45783935 CCTGGTGGTGAAGGTGGTGGGGG + Exonic
1109600084 13:64614284-64614306 CTTGCAGGTAAATGTCTTGGTGG + Intergenic
1110165355 13:72435831-72435853 CTTGGTGGTGATGGTGGTGGTGG + Intergenic
1113182885 13:107651672-107651694 CTGGAAGGTGAAGGTGTGGGTGG - Intronic
1113729936 13:112634188-112634210 CTTGCAGGTGGGGTTGTTGCGGG - Intergenic
1114550047 14:23527502-23527524 CAGGCAGGTGCATGTGTTGGGGG - Intronic
1114646812 14:24260550-24260572 CTTGCCGATGATGGCGTTGGGGG + Exonic
1114874797 14:26702245-26702267 CTTACAGGTAAAAGTCTTGGAGG + Intergenic
1118739320 14:68727601-68727623 CATGCAGGTCAAAGTGTAGGGGG - Intronic
1118799588 14:69177418-69177440 CTTGGAGGGGAAGGTGCTGCTGG + Intergenic
1120166237 14:81203969-81203991 CTTGCTGATGATGGTGATGGTGG + Exonic
1120855388 14:89207549-89207571 CTTGGGGGTGAAGGAGGTGGTGG + Intronic
1121528924 14:94639067-94639089 CTTGCTGGTGAGGGTGTAGATGG - Intergenic
1122171138 14:99876669-99876691 CTTGGAGCTGGAGGTGTGGGTGG - Intronic
1122664234 14:103317600-103317622 CTTGCGGGTGAAGGGAGTGGAGG + Intergenic
1124336794 15:28863204-28863226 TTTGCAAGAGAAGGTGGTGGAGG - Intergenic
1124940647 15:34214326-34214348 GTTGCTGGTGGAGGTGGTGGGGG + Intergenic
1125769455 15:42155544-42155566 CCTCCAGGTGAAGGTGCTGAGGG - Exonic
1127546754 15:59999924-59999946 CTTGCAGGTTTGGGTTTTGGGGG - Intergenic
1129329745 15:74820941-74820963 CTTCCAGGAGAGGGTCTTGGAGG + Intronic
1129546849 15:76404721-76404743 ATTGAAGGTGAAGATGTTGCTGG - Intronic
1130860140 15:87878515-87878537 CCTGGAGGTGAAGGTAATGGAGG - Intronic
1131558673 15:93420665-93420687 CTGGCAGGTGACAGGGTTGGAGG + Intergenic
1132077679 15:98835901-98835923 TTTGCTGTGGAAGGTGTTGGGGG + Intronic
1132119797 15:99167002-99167024 TTTGGAGGTGAGGGGGTTGGGGG - Intronic
1132700011 16:1218311-1218333 CGTGCTGGTGAACGTGGTGGTGG + Exonic
1132731005 16:1362061-1362083 CATGCCCGTGAAGGTGTTGTTGG - Exonic
1133747996 16:8701954-8701976 CATGGAGGTGTAGGTGTAGGGGG + Intronic
1137408501 16:48208481-48208503 CTTGCAGGGGATGATGTTAGGGG - Exonic
1137782807 16:51112065-51112087 CTTGCATTTGAAGGGGGTGGGGG + Intergenic
1138394243 16:56691889-56691911 TTTGGTGGGGAAGGTGTTGGTGG + Intronic
1138542146 16:57694952-57694974 CTTTCTGGGGAAGTTGTTGGTGG + Intronic
1140123933 16:72105068-72105090 CTTGCAGGTGCACCTGTCGGGGG + Exonic
1140767948 16:78177474-78177496 GTTGCAGGAGAAAGTATTGGTGG + Intronic
1141194804 16:81852362-81852384 CTTGTGGTTGAAGGTGGTGGGGG + Intronic
1142849114 17:2695800-2695822 CTTGGAGGCCACGGTGTTGGGGG + Intronic
1143353064 17:6303489-6303511 CTGGCTTGAGAAGGTGTTGGGGG + Intergenic
1143578190 17:7807407-7807429 CCTGGAGGTGAGGGGGTTGGTGG + Intronic
1143982291 17:10880347-10880369 CTGGTTGGTGAGGGTGTTGGTGG + Intergenic
1144584783 17:16481632-16481654 CTGGCAGGAGAAGGTGTCTGTGG + Intronic
1144776579 17:17787892-17787914 CCTGGAGGAGATGGTGTTGGGGG + Intronic
1145885880 17:28382140-28382162 CTTGCAGGGGTGGGCGTTGGGGG + Intronic
1146059173 17:29595587-29595609 GCTGCAGGTAGAGGTGTTGGGGG + Intronic
1147987293 17:44313989-44314011 CTTGCAAGTGGTGGTGGTGGTGG - Intronic
1148292283 17:46464101-46464123 CTAGCAGGTGTGGGTCTTGGTGG + Intergenic
1148314468 17:46681793-46681815 CTAGCAGGTGTGGGTCTTGGTGG + Intronic
1148344798 17:46895933-46895955 CTTGAAGGGGAAGCTGGTGGGGG + Intergenic
1148872606 17:50667720-50667742 CATCCAGGTGAAGGTGGTTGTGG - Exonic
1149753666 17:59169858-59169880 CTTTCTGGTGAGGGTGGTGGAGG - Exonic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1150345654 17:64402882-64402904 CTTGCAGGTGGAGCCTTTGGAGG + Intronic
1151081974 17:71340032-71340054 CTGGCATGTGTATGTGTTGGAGG + Intergenic
1151393353 17:73802686-73802708 CCTGCTGGAGATGGTGTTGGAGG - Intergenic
1152146887 17:78573775-78573797 GTTGAAGTTGAAGGTGTCGGCGG - Intronic
1152442004 17:80314918-80314940 GGTGGTGGTGAAGGTGTTGGTGG + Intronic
1152442174 17:80315621-80315643 CGTGGAGGTGATGGTGGTGGTGG + Intronic
1152690446 17:81715558-81715580 CTTCCACGAGAAGGTGTTGCTGG + Exonic
1152755729 17:82086253-82086275 CCTGAAGATGAAGGTGGTGGAGG - Exonic
1152756851 17:82090599-82090621 CCAGCAGGTGCAGCTGTTGGGGG + Intronic
1154066125 18:11109034-11109056 CTGGCAGCTGCAGTTGTTGGTGG - Intronic
1155382874 18:25244040-25244062 TGAGAAGGTGAAGGTGTTGGTGG - Intronic
1158251490 18:55492939-55492961 TTTGTGGGTGGAGGTGTTGGTGG - Intronic
1161130141 19:2583515-2583537 CTTGTTGGTGCAGGTGCTGGGGG + Intronic
1161130591 19:2586290-2586312 CTTGTTGGTGCAGGTGCTGGGGG + Intronic
1162128629 19:8512293-8512315 CTTCCTGGTCAGGGTGTTGGAGG - Intronic
1162186742 19:8911045-8911067 GATGCAGGTGATGGTGGTGGAGG - Intronic
1163529791 19:17842604-17842626 CTTGTAGCTGCAGGGGTTGGAGG + Exonic
1164595549 19:29528943-29528965 CTTGCAGGGGACGGGGTAGGGGG + Intronic
1165767854 19:38362023-38362045 CTTCCAGGGGAAGGCGTTGGGGG + Intronic
1166295589 19:41887843-41887865 CTTGCGGGGGCAGGCGTTGGAGG - Intronic
1166377243 19:42334390-42334412 CCTGCAGGTGAAGGTGGGGTGGG - Intronic
1167374275 19:49102768-49102790 CTAGCAGCTGAAGGTGTCGTAGG + Intronic
925481862 2:4284355-4284377 CTTGCAGGTGAACGGGAAGGAGG - Intergenic
927460629 2:23295445-23295467 GTTCCAGGTGGAGGGGTTGGAGG + Intergenic
928199393 2:29237720-29237742 CTTGCAGGGGATGGTAATGGTGG + Intronic
929884135 2:45863444-45863466 CTTGCAGGTAGAGCTGTTTGGGG - Intronic
931190684 2:59997122-59997144 GCTGCAGGTGAGGGTGTTGCTGG - Intergenic
931327809 2:61245220-61245242 CTTGCATCTGAATGTTTTGGTGG - Exonic
931746100 2:65293241-65293263 CATGGAGGTGAGGGTGTTGGTGG - Intergenic
931860985 2:66354329-66354351 CTTGCAGGTTAGGGTGATGCTGG - Intergenic
932801626 2:74746925-74746947 TCTGCAGGTGAATGTGGTGGTGG + Intergenic
932829440 2:74974887-74974909 CCAGCAGGTGAAGGTGATGGGGG - Intergenic
933251103 2:80029342-80029364 CTTGCAGGTGAAAGGGAGGGTGG + Intronic
934064677 2:88330037-88330059 ATTACAGGTGTAGGTGTTTGGGG + Intergenic
935178240 2:100668161-100668183 GTTGCAGGTGAAGATTTTGAAGG + Intergenic
938342691 2:130546150-130546172 AATGCAGGTGAAGGTGCGGGAGG - Intronic
938347142 2:130574572-130574594 AATGCAGGTGAAGGTGCGGGAGG + Intronic
939165740 2:138639508-138639530 CATTCAGGTGAAGGATTTGGTGG - Intergenic
940042291 2:149373147-149373169 GGTGCAGGAGAAGGTGTTGAGGG + Intronic
943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG + Intergenic
945122281 2:206469259-206469281 ATTGCAGGAGAAGGAGGTGGTGG - Intronic
946025251 2:216668042-216668064 TGTGCAGGTGCGGGTGTTGGGGG + Intergenic
948260521 2:236601056-236601078 CCTGCAGGAGCAGGTGGTGGTGG + Intergenic
1170479471 20:16751631-16751653 TTTGGAGGTAAAGCTGTTGGGGG + Exonic
1171388927 20:24788779-24788801 CTGGCAGGTGAAGGTTGTAGTGG - Intergenic
1173569474 20:44067232-44067254 CTTGCAGGAGAAGGGGGTGAGGG + Intronic
1173923892 20:46766143-46766165 GTTGCAGGTGCAGGTGTGGGTGG - Intergenic
1175688367 20:61047653-61047675 CTTGCAGGTGAGGTGGCTGGCGG - Intergenic
1175862025 20:62155672-62155694 CTGGCAGGAGATGGGGTTGGAGG - Intronic
1175883258 20:62272518-62272540 CTTGGAGCTGAAGGTGGCGGTGG + Intronic
1178482377 21:32990770-32990792 TTTGCAGGTCAAGGTGCTGGAGG - Intergenic
1179356783 21:40667247-40667269 CTTGTAGGTGAAGGTGGGGAGGG - Intronic
1179659052 21:42863059-42863081 GTTGGAAGTGAAGGTGTGGGAGG - Intronic
1179659156 21:42863535-42863557 CTCGGAGGAGAAGGTCTTGGTGG - Exonic
1180062157 21:45390988-45391010 GATGCAGGTGAAGGGGCTGGGGG - Intergenic
1180065997 21:45412721-45412743 CCTGCAAGTGAAGGTGCTTGAGG + Intronic
1180782711 22:18529794-18529816 GGTGCAGGTGAAGGTGATGGAGG + Intronic
1181126271 22:20703821-20703843 GGTGCAGGTGAAGGTGATGGAGG + Intergenic
1181239601 22:21469132-21469154 GGTGCAGGTGAAGGTGATGGAGG + Intergenic
1181485935 22:23231834-23231856 TTTGGAGCTGCAGGTGTTGGGGG + Intronic
1184651888 22:45923179-45923201 CGTGCAGGTGGAGGTGGTGCGGG - Exonic
1184814975 22:46862363-46862385 GTTGCAGATGGAGGTGCTGGTGG + Intronic
1185012994 22:48326353-48326375 CTGGCAGGTGAAGGTCAAGGTGG - Intergenic
1185175177 22:49322399-49322421 CGTGCAGGTGCAGGTGCAGGGGG + Intergenic
1185222089 22:49634213-49634235 CTTGGAGGTGGAAGTGCTGGAGG - Intronic
950807117 3:15614990-15615012 CTTCCATCTGAAGTTGTTGGGGG + Intronic
951534501 3:23728914-23728936 CTTGCAGGAGGAGGTGTGGCTGG + Intergenic
951925199 3:27901669-27901691 CTTGCAGATGAAAGTGTTGGTGG + Intergenic
952392881 3:32895697-32895719 CTTGCAGGTGATGGTGTCACAGG + Exonic
952527059 3:34221768-34221790 CTTGCGGGGAAGGGTGTTGGGGG + Intergenic
953002523 3:38948869-38948891 CTTGGAGGTATAGTTGTTGGAGG - Intronic
953035553 3:39207411-39207433 CTTGGTGGTGGGGGTGTTGGGGG + Intergenic
953793555 3:45966432-45966454 CTTGCAGGAGAAGCTGAAGGCGG - Exonic
955011007 3:55014226-55014248 ATTGATGGTGAAGGTGGTGGTGG + Intronic
959192270 3:103129783-103129805 TTTGGAGATGAAGGTGTTGAGGG - Intergenic
959528811 3:107408659-107408681 CATGCAGCTGCAGGGGTTGGCGG - Intergenic
961660427 3:128465884-128465906 GATGAAGGTGAAGGTGGTGGAGG + Exonic
963683297 3:148408500-148408522 CTTGAAGGTGGATGTGATGGTGG - Intergenic
964793988 3:160478232-160478254 GTTGGAGGTGAAGGTGTTATTGG + Intronic
964906776 3:161726803-161726825 ATTGAAGGAGAAGGGGTTGGGGG + Intergenic
965017875 3:163182837-163182859 CTTGCAGATGAAGATGATGAAGG - Intergenic
965031839 3:163380270-163380292 TTTGGAGGTGAAGGATTTGGAGG + Intergenic
966668972 3:182505868-182505890 CCTGGAGGTGAAGGTGTGTGTGG - Intergenic
968505199 4:968197-968219 CTGGGAGGTGGAGGAGTTGGCGG - Intronic
969211239 4:5689080-5689102 CTTCCAGGTGAATGTGTTCTGGG - Intronic
969235649 4:5863615-5863637 CCGGGAGGTGATGGTGTTGGGGG - Intronic
970509895 4:16771540-16771562 CTTGTAGGGGATGGAGTTGGGGG - Intronic
970512571 4:16795747-16795769 CCTACAGGTTAAGGTGGTGGGGG - Intronic
971044908 4:22794800-22794822 CTTGCAGATGAAGCTATTGTGGG + Intergenic
971455054 4:26836399-26836421 TTTGAAGCTGATGGTGTTGGAGG + Intergenic
972027402 4:34400424-34400446 TTTGCATGAGAAGGTGATGGTGG - Intergenic
977366344 4:96073322-96073344 ATTGTAGCTGAAGTTGTTGGTGG + Intergenic
978361214 4:107932263-107932285 CTAACAGGTGATGGTGGTGGCGG + Intronic
981559120 4:146027836-146027858 CCTGCATGTGAAGGTGTTCATGG - Intergenic
982375628 4:154687716-154687738 CAGGCAGGTGTAGGGGTTGGAGG + Intronic
982645863 4:158025178-158025200 ATTGCAGGTGAAGATGTGGACGG + Intergenic
983249451 4:165327758-165327780 CGTTCAGGTGAGGGGGTTGGAGG + Exonic
983468564 4:168126624-168126646 CTTGGAGAAGAAGGTGTGGGGGG - Intronic
985579463 5:689324-689346 CTGGCAGGTGCGGCTGTTGGTGG + Intronic
985594309 5:781383-781405 CTGGCAGGTGCGGCTGTTGGTGG + Intergenic
988609713 5:32712744-32712766 CAGGGAGGTGAAGGGGTTGGAGG + Intronic
990010753 5:50994713-50994735 CTTCTAGGTGATGGTGTTGCAGG - Intergenic
990856929 5:60279051-60279073 CTGGCAGGTGAAGGGGCAGGTGG + Intronic
991454520 5:66788446-66788468 CATGCAGGAGATGATGTTGGAGG + Intronic
991609562 5:68436306-68436328 CCTTCAGGTGAAGGCTTTGGGGG + Intergenic
992613755 5:78530722-78530744 CTGGCAGGTACAGGTGTTGTTGG - Intronic
993357067 5:86927566-86927588 CCTGCACGTGAAAGTGTTGACGG + Intergenic
993430532 5:87827164-87827186 CTTGCAGTTCAAGGTGAGGGAGG + Intergenic
995092344 5:108193181-108193203 CTTGCTGATGAAGGGGTTGCTGG + Intronic
995393123 5:111660950-111660972 CATGCAGTTCAAGCTGTTGGTGG + Intergenic
996543954 5:124658122-124658144 GTTTCAGGTGATAGTGTTGGGGG + Intronic
997257067 5:132437187-132437209 CCTGCAGGTGTAGGGGCTGGCGG + Intronic
998655286 5:144171575-144171597 CTTGGTGGTGATGGTGGTGGTGG - Intronic
1000434713 5:161194158-161194180 CTTGCAGGGTAAGGTGGTGTTGG - Intergenic
1001382499 5:171313674-171313696 CTTGGAGGTGGAGGTGACGGCGG - Intergenic
1001789366 5:174442610-174442632 CTTGCTGGTGAGGCTGTTGGTGG + Intergenic
1003530032 6:6929430-6929452 CTGGCAGGGGATGGTGGTGGAGG - Intergenic
1003543024 6:7034791-7034813 GTTGAAGATGAAGGTGGTGGTGG - Intergenic
1006258800 6:32852154-32852176 CTTGCAGGGAGAGGTGTTTGGGG - Exonic
1006983563 6:38163539-38163561 CCTAGAGGTGGAGGTGTTGGGGG + Intergenic
1007055979 6:38885234-38885256 GTTGGAGGAGCAGGTGTTGGAGG - Intronic
1007219176 6:40265055-40265077 CCTGAAGGTGCTGGTGTTGGAGG - Intergenic
1007492269 6:42232692-42232714 CTTGCAGGGGAAGATGGTGGTGG + Exonic
1010132019 6:72505453-72505475 CCTGGAGGTGATGGTATTGGTGG - Intergenic
1012443080 6:99280319-99280341 TTTGCAGGTGACTGTGGTGGTGG + Exonic
1016451472 6:144187311-144187333 CTTGCAGATGGCGGTGCTGGTGG + Exonic
1019490212 7:1309281-1309303 GATGGAGGTGATGGTGTTGGTGG + Intergenic
1020181526 7:5926383-5926405 CTTGCTGGTGATGGTCTTGCTGG + Exonic
1020279771 7:6644256-6644278 CTTGCAGGTGAAGGTGTTGGGGG + Intronic
1020301407 7:6798506-6798528 CTTGCTGGTGATGGTCTTGCTGG - Exonic
1020378441 7:7514764-7514786 CTTGCTGTGGAAGGAGTTGGAGG - Intronic
1020603834 7:10309899-10309921 CACCCAGGTGAAGTTGTTGGAGG + Intergenic
1021161046 7:17272994-17273016 ATTGGAGGTGAAGTTGTTAGTGG - Intergenic
1021482098 7:21129345-21129367 CTTGCAACTGAAGTTGTTGCTGG + Intergenic
1022736791 7:33083680-33083702 TTTGCAGGTGCAGATTTTGGTGG + Intergenic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1024607217 7:51031764-51031786 CTTGCAGGGGCAGGGCTTGGGGG + Intronic
1025927708 7:65972747-65972769 CTTCCAGGAGCAGGTGTTTGAGG - Intronic
1026038139 7:66844557-66844579 CTGGCTGGAGGAGGTGTTGGGGG + Intergenic
1026906129 7:74063665-74063687 CTTGGAGTTCCAGGTGTTGGGGG + Exonic
1029381900 7:100220378-100220400 CTTGCAGCAGAAGGTGGTGTTGG - Exonic
1029402064 7:100352828-100352850 CTTGCAGCAGAAGGTGGTGTTGG - Exonic
1029403357 7:100358594-100358616 CCTGTGGGTGAAGGTGTGGGAGG + Intronic
1033363519 7:140654680-140654702 GGTGCTGGTGACGGTGTTGGTGG - Intronic
1033788881 7:144767852-144767874 CTTACAGGTGGTGGTGGTGGTGG - Intronic
1033810015 7:145001647-145001669 CATGCAGGTGTCGGTGGTGGTGG + Intergenic
1034544349 7:151780139-151780161 CTTGGAGGTGGAGGGGATGGTGG - Intronic
1035227070 7:157439554-157439576 CCTGGAGGTGAAGGTGATGGAGG - Intergenic
1035400806 7:158564459-158564481 CTTGCTGGTGTTGGTGATGGGGG - Intronic
1035598207 8:878401-878423 CTTCCTTGTGAAGGTGGTGGTGG + Intergenic
1036103218 8:5810699-5810721 ATTGCAGGTGATGGTGGAGGTGG - Intergenic
1037024011 8:14009706-14009728 CTAGCAGATGAAGCTTTTGGAGG + Intergenic
1037735302 8:21561133-21561155 TTTGCAGGTGAGGGTGGTGGTGG - Intergenic
1038575232 8:28699272-28699294 CTTGCAGGTGGAGATGATGCAGG + Intronic
1039316017 8:36373371-36373393 CTTGCAGGATAAGGTTGTGGAGG - Intergenic
1039484330 8:37899363-37899385 CGTGCAGGTGACGGTGCTGCAGG - Exonic
1045340352 8:101248994-101249016 CTTGCTGCTGAAGTTATTGGTGG - Intergenic
1047906031 8:129474152-129474174 CATGCAGCTGCAGGTGTGGGGGG + Intergenic
1048133467 8:131722443-131722465 TTTGCTGGTGAAGGTGATGATGG + Intergenic
1048934543 8:139344102-139344124 CTTGCAGGGGATGCTGTTGAAGG + Intergenic
1049296053 8:141839682-141839704 GTTGGTGGTGATGGTGTTGGTGG + Intergenic
1050388649 9:5114097-5114119 CTGGCAGGTGTAGGTGTGGTCGG - Intronic
1051604807 9:18908678-18908700 CTTGAAGGTGGAGGTGGAGGAGG - Exonic
1051855735 9:21562147-21562169 CTTGCAGGTAAAGGTTGAGGAGG - Intergenic
1051930471 9:22379333-22379355 ATTGAAGGTGGAGGCGTTGGTGG + Intergenic
1052701811 9:31947081-31947103 GTTGCATGTAAAGGTGTTTGTGG - Intergenic
1053165811 9:35842759-35842781 CTTGAAGGGGAAGGTGTCAGGGG + Intronic
1055319744 9:75071652-75071674 CTTGCAGGTTCAGGTGGGGGTGG + Intronic
1057749653 9:97781629-97781651 CTTTCAGGTGAACGACTTGGAGG - Intergenic
1057750764 9:97791002-97791024 CTTGCTGGAGCAGGTTTTGGGGG - Intergenic
1057981773 9:99670709-99670731 CTTGAAGGAGAAGGGGTTGAGGG - Intergenic
1058056599 9:100455093-100455115 CATGGAGGTGATGGTGTTTGAGG - Intronic
1058727122 9:107814867-107814889 ACTGCAGGAGAAGGTGTAGGAGG + Intergenic
1059449330 9:114360480-114360502 CCTGCAGTTGAAGGTATTGCAGG - Intronic
1059531607 9:115040456-115040478 CGGGGAGGTGAAGGTGATGGTGG + Intronic
1062098354 9:134714480-134714502 GATGCTGGTGAAGGTGGTGGTGG + Intronic
1062098409 9:134714765-134714787 GATGCTGGTGAAGGTGGTGGTGG + Intronic
1062098435 9:134714882-134714904 GATGCTGGTGAAGGTGGTGGTGG + Intronic
1062529546 9:136993886-136993908 CAGGCAGGTGGAGGTGGTGGCGG - Exonic
1186816765 X:13245966-13245988 TTAGCAGGTGAAGGAGGTGGCGG + Intergenic
1188651702 X:32638562-32638584 CTTGCAGATCAAGGTGGTGTAGG - Intronic
1190323702 X:49193591-49193613 CCTTCAGGTGAAAGTGTTGTGGG - Intronic
1192771991 X:74202884-74202906 CGTGCAGGTGACAGTGTTGCAGG + Intergenic
1197231172 X:124005372-124005394 CTTGATGGTGATGGTGATGGTGG - Intronic
1197500466 X:127235023-127235045 CTCCCAGGAGAAGGGGTTGGAGG - Intergenic
1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG + Intergenic
1201038421 Y:9805704-9805726 TTTGCAGGGGAAGATGATGGGGG - Intergenic
1201610368 Y:15836169-15836191 CTTGCAGGTGTATGTCTTGCAGG - Intergenic