ID: 1020280502

View in Genome Browser
Species Human (GRCh38)
Location 7:6647769-6647791
Sequence TAGCCCACACACACCACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020280502_1020280509 26 Left 1020280502 7:6647769-6647791 CCATGGGTGGTGTGTGTGGGCTA 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1020280509 7:6647818-6647840 GAGATGTGTGTGGGGTCCCGTGG No data
1020280502_1020280506 16 Left 1020280502 7:6647769-6647791 CCATGGGTGGTGTGTGTGGGCTA 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1020280506 7:6647808-6647830 TCAGTGATGTGAGATGTGTGTGG No data
1020280502_1020280508 18 Left 1020280502 7:6647769-6647791 CCATGGGTGGTGTGTGTGGGCTA 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1020280508 7:6647810-6647832 AGTGATGTGAGATGTGTGTGGGG No data
1020280502_1020280507 17 Left 1020280502 7:6647769-6647791 CCATGGGTGGTGTGTGTGGGCTA 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1020280507 7:6647809-6647831 CAGTGATGTGAGATGTGTGTGGG No data
1020280502_1020280510 30 Left 1020280502 7:6647769-6647791 CCATGGGTGGTGTGTGTGGGCTA 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1020280510 7:6647822-6647844 TGTGTGTGGGGTCCCGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020280502 Original CRISPR TAGCCCACACACACCACCCA TGG (reversed) Intronic
900198918 1:1393667-1393689 GAGCCCAGCCACACAACCCACGG + Intronic
902271219 1:15306612-15306634 TATCCCACCCACTCCAACCATGG + Intronic
902509426 1:16958056-16958078 CAGCCCACACACACCAGACTGGG - Intronic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904797892 1:33071169-33071191 TAGCCCAAACACTGCAGCCAGGG - Intronic
905630116 1:39513893-39513915 GAGCCCACAGAGACCAGCCAGGG + Intronic
905667643 1:39772297-39772319 GAGCCCACAGAGACCAGCCAGGG - Intronic
907660430 1:56387490-56387512 CACCCCACACAAACCACCCCTGG + Intergenic
908646918 1:66288269-66288291 TACCGCAAACACACCACCAAGGG + Intronic
912472581 1:109915745-109915767 TCCCCCACACACCCCACCCTGGG - Intronic
912572142 1:110632506-110632528 TTGCCCACTCACTCAACCCATGG - Intergenic
916177562 1:162055359-162055381 CAGCCCCGACTCACCACCCAGGG + Intergenic
919774351 1:201184354-201184376 TAACCAATGCACACCACCCACGG + Intergenic
922981685 1:229832205-229832227 GACCACACAAACACCACCCAAGG - Intergenic
924325368 1:242890080-242890102 GAGCCCTCAAACACCACCCCTGG - Intergenic
1062798728 10:363534-363556 GAGGCCACACACAGCACCCGCGG + Intronic
1063537644 10:6900742-6900764 TAGCACACACACACCCCCTCTGG - Intergenic
1065872398 10:29966716-29966738 TAGCCACCACACTCCACCCTGGG - Intergenic
1065887237 10:30089241-30089263 AAGCCCACCCTCACCACCTAGGG - Intronic
1066037557 10:31508652-31508674 ATGCCTACACACACCACCAAGGG - Intronic
1068364688 10:56031627-56031649 TAGACTACAATCACCACCCAAGG - Intergenic
1069393565 10:67963726-67963748 AAACCCTCACACACCAACCAGGG - Intronic
1070355488 10:75635844-75635866 GAGCCCACAACCACAACCCATGG - Intronic
1070415057 10:76181479-76181501 AAGCCAACAAATACCACCCACGG - Intronic
1070702926 10:78616487-78616509 GAACCCACACAAACAACCCAGGG - Intergenic
1072569787 10:96648517-96648539 AAGCCCACACATACTGCCCATGG + Intronic
1072761656 10:98061802-98061824 GCGCACACACACACCAGCCAAGG - Intergenic
1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG + Intronic
1076586531 10:131552227-131552249 TGGCTCACACATGCCACCCATGG - Intergenic
1076700776 10:132271545-132271567 GACCCCACACACAGCACTCAGGG + Intronic
1076758828 10:132589874-132589896 GAGCCCACAGCCTCCACCCAGGG + Intronic
1077124045 11:924753-924775 TGGCCCAGACCCACCAGCCAGGG - Intergenic
1080994253 11:37580791-37580813 TTGCCCACACAGACCACACTTGG - Intergenic
1083262013 11:61528285-61528307 CAGCCCACACTCACATCCCACGG + Intronic
1084063310 11:66689485-66689507 CAGCCCAGCCACACAACCCATGG + Intronic
1084664802 11:70570602-70570624 CAGCCCACACACACCACTGGAGG - Intronic
1087144036 11:94794295-94794317 TACCGCACACACAACATCCATGG - Intronic
1089553669 11:119302143-119302165 TGGCACACACACACAACACAGGG - Exonic
1090872549 11:130761110-130761132 TGACCCAGACACACCAGCCAAGG - Intergenic
1091090550 11:132767272-132767294 GTGCACACACACACCACCCAGGG - Intronic
1094579716 12:31723224-31723246 ACGCACACACACACCACCCCTGG + Intronic
1095225297 12:39671702-39671724 CCACACACACACACCACCCAGGG - Intronic
1098439759 12:70504966-70504988 GAGCCCCCACCCACCAACCAAGG - Intergenic
1101157425 12:101940958-101940980 TAGCCCACAGAAACCAGCAAAGG + Intronic
1102300140 12:111765868-111765890 CAGCCCACAGAAACCTCCCATGG + Intronic
1102341525 12:112125687-112125709 TCGCCCACACACCCCTCCCTTGG - Exonic
1102547316 12:113666208-113666230 TAGCCCAGACAAAACACCCCTGG + Intergenic
1103295802 12:119885752-119885774 TAGCACACACACCCCAGCCATGG + Intergenic
1103716233 12:122947022-122947044 CAAACCACACACACCGCCCATGG - Intronic
1104793521 12:131499450-131499472 TACTCCTCAAACACCACCCAGGG + Intergenic
1104992446 12:132633767-132633789 TAGGCCTCACAGACCAGCCAGGG + Intronic
1105069552 12:133226390-133226412 CAGTCCCCACAGACCACCCAAGG - Exonic
1105587349 13:21757252-21757274 TTGCCCACACTCACCATCCCAGG - Intergenic
1110567236 13:76968508-76968530 GAGCCCCCACACCCCAGCCAAGG - Intergenic
1112374627 13:98827577-98827599 TAGCCAACACACACCAGCAGAGG + Intronic
1113421124 13:110172131-110172153 GAGCTCACACACAGCATCCATGG - Intronic
1113839440 13:113350473-113350495 TATCCCATACACACACCCCATGG + Intronic
1118622682 14:67628254-67628276 TAGCCCCCACACTCCAGCCTGGG - Intronic
1119112367 14:71986973-71986995 GAGCCCACACACATAATCCAGGG + Intronic
1120680689 14:87477489-87477511 TAGCCCAGACACTCCAGCCTGGG - Intergenic
1123089859 14:105737708-105737730 CAGACCCCACACACCAGCCATGG - Intergenic
1124178976 15:27455633-27455655 TCACACACACAAACCACCCACGG - Intronic
1124602752 15:31148799-31148821 CAGCACACAGACACCACCCCAGG + Intronic
1125234944 15:37502264-37502286 TAGCCCACGCCCTCCACCAAGGG + Intergenic
1127393850 15:58527984-58528006 CAGCCCACACTCCCCACCCACGG + Intronic
1128797961 15:70478716-70478738 TTGCCCCAAGACACCACCCAGGG - Intergenic
1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG + Intronic
1132601088 16:773315-773337 TGGACCCCACACACCCCCCAGGG - Intronic
1135686063 16:24499238-24499260 TAGCCAACACAGACCAGGCATGG - Intergenic
1138415747 16:56870421-56870443 AAGGCCACACACACCCCCAAAGG - Intronic
1138685462 16:58721415-58721437 CAGCCCCCACAGTCCACCCATGG + Intronic
1141118688 16:81333898-81333920 CAGCACACACACAGCACCCCAGG - Intronic
1141622079 16:85241713-85241735 AAGCCCTCCCACACCACCCTAGG - Intergenic
1141994377 16:87627412-87627434 TAGACCACTGAGACCACCCATGG + Intronic
1142308578 16:89299376-89299398 GACCCCACACACCCCACACAGGG - Intronic
1142308603 16:89299466-89299488 GACCCCACACACCCCACACAGGG - Intronic
1142308714 16:89299853-89299875 GACCCCACACACCCCACACAGGG - Intronic
1142308746 16:89299970-89299992 GACCCCACACACCCCACACAGGG - Intronic
1142308811 16:89300195-89300217 GACCCCACACACCCCACACAGGG - Intronic
1146919801 17:36703012-36703034 AAGCTCCCACACATCACCCAGGG - Intergenic
1148897082 17:50845225-50845247 CAGCACACACATACCACTCAGGG + Intergenic
1150693785 17:67386715-67386737 AAGCCCACACAAGCCAGCCAGGG - Intronic
1150786884 17:68170252-68170274 CAGCCCAAACACACCATCCATGG + Intergenic
1151265655 17:72953133-72953155 TACCACCCACCCACCACCCAGGG + Intronic
1152544865 17:80995347-80995369 TGACCTACCCACACCACCCAGGG - Intronic
1156034718 18:32753616-32753638 TAGCCCACCCCCACCACCCAAGG + Intronic
1158496058 18:57956138-57956160 TGGCCCACATACAGCAGCCAGGG - Intergenic
1159111893 18:64069444-64069466 CATACCACACACACTACCCAAGG - Intergenic
1160471085 18:79134341-79134363 CAGCCCACACATACATCCCATGG + Intronic
1161772095 19:6236447-6236469 TTGCCCACACAAACCAAACAGGG + Intronic
1163492509 19:17625076-17625098 TAGCCCCATCAAACCACCCAGGG - Intronic
1164588342 19:29491720-29491742 CAGCCAACACACAGCAGCCAGGG + Intergenic
1165017469 19:32891253-32891275 CAACCCAAGCACACCACCCAGGG + Intronic
1165489087 19:36113051-36113073 TACCCCACATACACAAACCATGG - Intronic
1166691411 19:44823307-44823329 TTGCACTCACACACCACCCAGGG + Intergenic
925340509 2:3132439-3132461 CAGCCCAGACACAGCACCCTTGG + Intergenic
926044888 2:9703238-9703260 TGTCCCACAAACACCAACCAGGG - Intergenic
926395820 2:12441074-12441096 TGGCCCAGAGACACCACACAGGG + Intergenic
927326331 2:21809874-21809896 TAGGCTACAAACACCAACCAAGG - Intergenic
931906455 2:66848783-66848805 TGCCCCACACCCCCCACCCAGGG + Intergenic
932413046 2:71558501-71558523 TGGCCCACCCACCTCACCCAAGG - Intronic
932477111 2:72013226-72013248 CAGCTCACCCACACCACCCTTGG + Intergenic
933996863 2:87676499-87676521 AAGGCCACACTCACCCCCCAAGG + Intergenic
934504189 2:94878774-94878796 TCGCCCCCACCCACCTCCCATGG - Intergenic
934577931 2:95414661-95414683 TCTCCCACCCACCCCACCCAAGG + Exonic
934601507 2:95662041-95662063 TCTCCCACCCACCCCACCCAAGG - Intergenic
934689585 2:96348004-96348026 TATGCTACACACATCACCCACGG - Intronic
936296988 2:111274411-111274433 AAGGCCACACTCACCCCCCAAGG - Intergenic
936534870 2:113304205-113304227 TCTCCCACCCACCCCACCCAAGG - Intergenic
937998099 2:127710431-127710453 CAGCCCACAGCCTCCACCCAGGG + Intronic
938104854 2:128522958-128522980 CAGCCCAGACACACCTCCCTGGG - Intergenic
938240201 2:129737615-129737637 GTGCCCACACTCACCACCCAGGG + Intergenic
940003912 2:148994189-148994211 TTCCCCACAGACACCACTCATGG - Intronic
941262429 2:163314588-163314610 CAGTCCACACACTCTACCCAGGG + Intergenic
941325140 2:164104885-164104907 TATCCCACACACATCATCTATGG + Intergenic
944199097 2:197086258-197086280 AAGTGCACACACACCACCAATGG - Intronic
944667031 2:201967233-201967255 GAGCCCCCACCCACCACCCACGG - Intergenic
945019577 2:205557480-205557502 TAGCTCACACACGCTTCCCAAGG + Intronic
946171838 2:217900334-217900356 TTGCCCACACTCCCCACCCGTGG + Intronic
949025295 2:241764991-241765013 TAGCCCACACTGAGCCCCCAGGG - Intronic
1169823634 20:9742087-9742109 TATCCAACCCTCACCACCCAAGG + Intronic
1172165072 20:32893923-32893945 TAGCCCCCACTCACCAGGCAGGG - Intronic
1173274392 20:41566753-41566775 GAGACACCACACACCACCCAGGG - Intronic
1173557057 20:43973766-43973788 TTGCCACCACACAGCACCCACGG + Intronic
1176084939 20:63291552-63291574 GAGCCACCACACCCCACCCATGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176346629 21:5754326-5754348 TCACACACACACACCAGCCAAGG - Intergenic
1176353443 21:5874910-5874932 TCACACACACACACCAGCCAAGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176498198 21:7570129-7570151 TCACACACACACACCAGCCAAGG + Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176540950 21:8152396-8152418 TCACACACACACACCAGCCAAGG - Intergenic
1176559901 21:8335441-8335463 TCACACACACACACCAGCCAAGG - Intergenic
1177638888 21:23820879-23820901 TACCCCCACCACACCACCCAGGG + Intergenic
1180521131 22:16206000-16206022 TGACCCAAACACACCACACAAGG + Intergenic
1180634942 22:17256830-17256852 GAGCCAACACACCCCACCTAAGG + Intergenic
1180729367 22:17970124-17970146 GAGCCCACAGACCCCACTCAGGG - Intronic
1181559627 22:23692558-23692580 TAGCCCCAAAACACCACCCCCGG - Intronic
1181635933 22:24174886-24174908 TAGGCCACACACACCTCCCTGGG + Intronic
1183384852 22:37508994-37509016 TGGCCCTCACCCACCATCCAGGG + Intronic
1183581776 22:38730714-38730736 TGGCCCACCCTCACCACCCAAGG + Exonic
1183759029 22:39799020-39799042 GGGCCCAGACACACCACCTAGGG - Intronic
1203245889 22_KI270733v1_random:68815-68837 TCACACACACACACCAGCCAAGG - Intergenic
953796791 3:45992157-45992179 TAGCACAAATACACCTCCCAAGG + Intronic
953913572 3:46904754-46904776 CAGCCCACACACACCCCATAGGG + Intergenic
955632874 3:60993559-60993581 AAGGCAATACACACCACCCAGGG + Intronic
956648306 3:71478979-71479001 GAGCCCACACACACAACACTGGG - Intronic
957665403 3:83218795-83218817 TAGTGCACACACACCAAACAAGG + Intergenic
957988198 3:87597380-87597402 TATCCCAGCCACACCAGCCATGG - Intergenic
958606524 3:96364823-96364845 GTGCCCACACATACCACCCAGGG + Intergenic
961202108 3:125053552-125053574 TGCCCCACAGACACCACCCAAGG - Intronic
962333724 3:134505804-134505826 GAGTCCACACACACCACTTAGGG - Intronic
967218531 3:187229887-187229909 GAGCCCACACACTGCATCCAAGG + Intronic
969266416 4:6066906-6066928 CACCCCACACACACCTGCCATGG + Intronic
971369333 4:26003271-26003293 CACCCCACACACCCCTCCCAGGG + Intergenic
973982179 4:56315843-56315865 GAGCCCGCAGACACCACCGAGGG + Exonic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
976914847 4:90359959-90359981 TTGCTCCCACACACCAGCCAGGG - Intronic
978080870 4:104589865-104589887 TAGCCCTCACCCACCAGCCTAGG - Intergenic
981748587 4:148073066-148073088 TGGCTCACACAAACCACCCAGGG - Intergenic
985390803 4:189490558-189490580 CAGCCCACCCACACCACCGAGGG - Intergenic
985390812 4:189490588-189490610 CAGCCCACCCACACCACCGAGGG - Intergenic
985390833 4:189490678-189490700 CAGCCCACCTACACCACCGAGGG - Intergenic
985390864 4:189490798-189490820 CAGCCCACCTACACCACCGAGGG - Intergenic
985390898 4:189490918-189490940 CAGCCCACCCACACCACCGAGGG - Intergenic
985390905 4:189490948-189490970 CAGCTCACCCACACCACCGAGGG - Intergenic
985390944 4:189491098-189491120 CAGCCCACCCACACCATCGAGGG - Intergenic
985390974 4:189491218-189491240 CAGCCCACCCACACCATCGAGGG - Intergenic
985390991 4:189491278-189491300 CAGCCCACCCACACCACCGAGGG - Intergenic
985391038 4:189491458-189491480 CAGCCCACCCACACCACCGAGGG - Intergenic
985391055 4:189491518-189491540 CAGCCCACCCACACCACCGAGGG - Intergenic
985391072 4:189491578-189491600 CAGCCCACCCACACCACCGAGGG - Intergenic
985391089 4:189491638-189491660 CAGCCCACCCACACCACCGAGGG - Intergenic
985391135 4:189491818-189491840 CAGCCCACCCACACCACCGAGGG - Intergenic
985391152 4:189491878-189491900 CAGCCCACCCACACCACCGAGGG - Intergenic
985391177 4:189491968-189491990 CAGCCCACCCACACCACCGAGGG - Intergenic
990289503 5:54334194-54334216 TTGCCCACACTCACCATCCAGGG + Intergenic
990894291 5:60681252-60681274 TTGCCCACTACCACCACCCAAGG + Intronic
992548539 5:77839686-77839708 TAAGCCCCACACACCACTCATGG + Intronic
994497015 5:100525830-100525852 AAACACACACACACCCCCCATGG + Intergenic
996115052 5:119608994-119609016 CAGCACAGACACACCACCCCTGG - Intronic
997097553 5:130929999-130930021 AAGCCCACACAAAACATCCAAGG + Intergenic
998281187 5:140808931-140808953 TGGCCCACACCCACCGACCATGG - Exonic
998388804 5:141773885-141773907 TGCCCCACTCACACCTCCCAGGG - Intergenic
999111916 5:149128818-149128840 CTGCCCACACAGACTACCCAAGG + Intergenic
1001840580 5:174873075-174873097 CAGCCCACACCCACCAGCGAAGG - Intergenic
1004249343 6:14010640-14010662 TAGAAGACACACACCAACCAGGG - Intergenic
1007473681 6:42105919-42105941 TTGGCCAGCCACACCACCCAAGG - Exonic
1007812345 6:44495503-44495525 TTCCCCACAGCCACCACCCAGGG + Intergenic
1010333074 6:74646943-74646965 TCACCCACACACTTCACCCAGGG + Intergenic
1015136942 6:129882890-129882912 GAGCCCCCACACCCCAGCCAAGG - Intergenic
1018886840 6:167946052-167946074 AAGCAAACACACACCACCCAAGG + Intronic
1019073990 6:169372142-169372164 CACACCACACACACCACACACGG + Intergenic
1019074009 6:169372333-169372355 CACACCACACACACCACACACGG + Intergenic
1019155722 6:170037666-170037688 CTGCCCAGACACACCTCCCAGGG + Intergenic
1019928885 7:4210510-4210532 TCGCCGACAGAGACCACCCAGGG + Intronic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1025281873 7:57632368-57632390 TAGACCTCACACTCCAGCCAGGG - Intergenic
1025302856 7:57833149-57833171 TAGACCTCACACTCCAGCCAGGG + Intergenic
1029041372 7:97580011-97580033 GAGCCCCCACACCCCAGCCAAGG + Intergenic
1031016784 7:116584268-116584290 TGGCTCACAAATACCACCCAGGG + Intergenic
1035734902 8:1881054-1881076 TAGCTCACACACCCCTCCCATGG - Intronic
1038292929 8:26266062-26266084 TACCACACACACCCAACCCACGG - Intergenic
1038537184 8:28361659-28361681 CAGCACACACACATCAACCACGG + Intronic
1039873757 8:41568150-41568172 GCGCACGCACACACCACCCACGG - Intergenic
1041106886 8:54453531-54453553 TAGCCCACACACCTCAACCCGGG + Intergenic
1044712108 8:95067953-95067975 ACTCCCACCCACACCACCCAAGG - Intronic
1047964864 8:130039082-130039104 TACCCCACGCTCACCAGCCAGGG - Intergenic
1049864439 8:144924846-144924868 CTGCCCACACACCCCACCCCAGG - Intergenic
1055452854 9:76446331-76446353 GAGCCAGCACACAGCACCCAGGG + Intronic
1056636787 9:88337908-88337930 TGGCCCAGAGACAGCACCCAAGG + Intergenic
1056738708 9:89234302-89234324 TTGCTAATACACACCACCCATGG + Intergenic
1058887198 9:109330447-109330469 TAGGCAACAAAGACCACCCAGGG - Intergenic
1061325785 9:129863320-129863342 CAGTCCCCACACACCGCCCAAGG - Intronic
1062023889 9:134331728-134331750 TGGCCCACAGACCTCACCCAGGG - Intronic
1062286320 9:135774245-135774267 GACACCACACACACCACACACGG - Intronic
1062360600 9:136186222-136186244 TAGCCCACACCCCCCTCCCAGGG + Intergenic
1062429127 9:136519210-136519232 CGGCCCACACAGACCAACCAGGG + Intronic
1203462224 Un_GL000220v1:51887-51909 TCACACACACACACCAGCCAAGG - Intergenic
1187308980 X:18122624-18122646 CACCCCTCACACACAACCCAAGG - Intergenic
1188041018 X:25369770-25369792 TTGCTTATACACACCACCCAGGG - Intergenic
1191255933 X:58279646-58279668 CAGCCCCCGCACCCCACCCAGGG - Intergenic
1191675263 X:63785938-63785960 TATCTCACACACACCACTCCAGG + Intergenic
1193168009 X:78303453-78303475 GCGCCCACACACACCTCACAAGG - Intronic
1194872276 X:99147006-99147028 GTGCCCACACACACCACCAGGGG + Intergenic
1195749325 X:108148534-108148556 ACACACACACACACCACCCATGG + Intronic
1200820896 Y:7581399-7581421 TAGCCCACAGGCACCACACTGGG + Intergenic
1201222886 Y:11789077-11789099 GAGCCCTCAAACACCACCCCTGG - Intergenic
1202239410 Y:22751343-22751365 TAGCCCACAGGCACCACACTGGG - Intergenic
1202392397 Y:24385105-24385127 TAGCCCACAGGCACCACACTGGG - Intergenic
1202478387 Y:25285012-25285034 TAGCCCACAGGCACCACACTGGG + Intergenic