ID: 1020281794

View in Genome Browser
Species Human (GRCh38)
Location 7:6653592-6653614
Sequence CGCGCGTTCGGGCCCGCCAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020281782_1020281794 20 Left 1020281782 7:6653549-6653571 CCCTTTCGGCGGCGGCGGGGCCG 0: 1
1: 0
2: 2
3: 10
4: 113
Right 1020281794 7:6653592-6653614 CGCGCGTTCGGGCCCGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 17
1020281783_1020281794 19 Left 1020281783 7:6653550-6653572 CCTTTCGGCGGCGGCGGGGCCGC 0: 1
1: 0
2: 0
3: 18
4: 147
Right 1020281794 7:6653592-6653614 CGCGCGTTCGGGCCCGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 17
1020281790_1020281794 0 Left 1020281790 7:6653569-6653591 CCGCGGGCGGCGGAGGCGGCCTG 0: 1
1: 0
2: 2
3: 46
4: 433
Right 1020281794 7:6653592-6653614 CGCGCGTTCGGGCCCGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020281794 Original CRISPR CGCGCGTTCGGGCCCGCCAT CGG Exonic
1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG + Exonic
1102157603 12:110743125-110743147 CTCTCGCTCGGGCCCGGCATTGG - Intergenic
1104697279 12:130872516-130872538 CGCGGGAGCGGGGCCGCCATGGG + Intronic
1119519724 14:75277170-75277192 CGCGCGGCCGGGCGCGCCGTCGG - Intergenic
1140685985 16:77434635-77434657 TGCGGGTTCGGGCCCGCCGAGGG - Exonic
1142978336 17:3658017-3658039 CGCGTGTCCTGGCCTGCCATCGG + Exonic
1148077552 17:44947594-44947616 CGCGCGGTCGGTTCCGCCGTGGG + Intronic
1160763698 19:797935-797957 CGCGCGTGCGCGGCCGCCATCGG + Intronic
937045251 2:118847876-118847898 CGCGAGTCCCGGCTCGCCATTGG - Intergenic
949004308 2:241636857-241636879 CCCGCGTTCGGGCCGGCCGCGGG + Intronic
1172277305 20:33686560-33686582 CGCGCGCCCCGCCCCGCCATTGG - Intergenic
955239296 3:57165188-57165210 CGCGCGGCCGGACCCGCCAGCGG + Exonic
962804202 3:138915569-138915591 GGCGCGCTCGGGGCCGCCAGGGG - Intergenic
997319086 5:132963337-132963359 CGCGCATTCGAGCCCGCCCAGGG + Exonic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020281794 7:6653592-6653614 CGCGCGTTCGGGCCCGCCATCGG + Exonic
1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG + Intronic
1058467621 9:105244851-105244873 GGCTCCTTCGGCCCCGCCATGGG + Exonic
1062389305 9:136327693-136327715 GGCGGGGCCGGGCCCGCCATGGG - Exonic