ID: 1020285867

View in Genome Browser
Species Human (GRCh38)
Location 7:6680100-6680122
Sequence GCTGCCACCCTGTTGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020285867_1020285874 29 Left 1020285867 7:6680100-6680122 CCATTTGCCAACAGGGTGGCAGC No data
Right 1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG No data
1020285867_1020285875 30 Left 1020285867 7:6680100-6680122 CCATTTGCCAACAGGGTGGCAGC No data
Right 1020285875 7:6680153-6680175 ACCTGGATTTCCTTGCAGCAGGG No data
1020285867_1020285870 13 Left 1020285867 7:6680100-6680122 CCATTTGCCAACAGGGTGGCAGC No data
Right 1020285870 7:6680136-6680158 TTCTTTCTCCCTCCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020285867 Original CRISPR GCTGCCACCCTGTTGGCAAA TGG (reversed) Intergenic
No off target data available for this crispr