ID: 1020285868

View in Genome Browser
Species Human (GRCh38)
Location 7:6680107-6680129
Sequence CACAACAGCTGCCACCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020285868_1020285874 22 Left 1020285868 7:6680107-6680129 CCAACAGGGTGGCAGCTGTTGTG No data
Right 1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG No data
1020285868_1020285875 23 Left 1020285868 7:6680107-6680129 CCAACAGGGTGGCAGCTGTTGTG No data
Right 1020285875 7:6680153-6680175 ACCTGGATTTCCTTGCAGCAGGG No data
1020285868_1020285870 6 Left 1020285868 7:6680107-6680129 CCAACAGGGTGGCAGCTGTTGTG No data
Right 1020285870 7:6680136-6680158 TTCTTTCTCCCTCCTCTACCTGG No data
1020285868_1020285877 24 Left 1020285868 7:6680107-6680129 CCAACAGGGTGGCAGCTGTTGTG No data
Right 1020285877 7:6680154-6680176 CCTGGATTTCCTTGCAGCAGGGG No data
1020285868_1020285878 25 Left 1020285868 7:6680107-6680129 CCAACAGGGTGGCAGCTGTTGTG No data
Right 1020285878 7:6680155-6680177 CTGGATTTCCTTGCAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020285868 Original CRISPR CACAACAGCTGCCACCCTGT TGG (reversed) Intergenic
No off target data available for this crispr