ID: 1020285869

View in Genome Browser
Species Human (GRCh38)
Location 7:6680131-6680153
Sequence TAGAGGAGGGAGAAAGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020285869_1020285875 -1 Left 1020285869 7:6680131-6680153 CCTCATTCTTTCTCCCTCCTCTA No data
Right 1020285875 7:6680153-6680175 ACCTGGATTTCCTTGCAGCAGGG No data
1020285869_1020285878 1 Left 1020285869 7:6680131-6680153 CCTCATTCTTTCTCCCTCCTCTA No data
Right 1020285878 7:6680155-6680177 CTGGATTTCCTTGCAGCAGGGGG No data
1020285869_1020285877 0 Left 1020285869 7:6680131-6680153 CCTCATTCTTTCTCCCTCCTCTA No data
Right 1020285877 7:6680154-6680176 CCTGGATTTCCTTGCAGCAGGGG No data
1020285869_1020285874 -2 Left 1020285869 7:6680131-6680153 CCTCATTCTTTCTCCCTCCTCTA No data
Right 1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG No data
1020285869_1020285880 15 Left 1020285869 7:6680131-6680153 CCTCATTCTTTCTCCCTCCTCTA No data
Right 1020285880 7:6680169-6680191 AGCAGGGGGCAGACTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020285869 Original CRISPR TAGAGGAGGGAGAAAGAATG AGG (reversed) Intergenic
No off target data available for this crispr