ID: 1020285874

View in Genome Browser
Species Human (GRCh38)
Location 7:6680152-6680174
Sequence TACCTGGATTTCCTTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020285868_1020285874 22 Left 1020285868 7:6680107-6680129 CCAACAGGGTGGCAGCTGTTGTG No data
Right 1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG No data
1020285869_1020285874 -2 Left 1020285869 7:6680131-6680153 CCTCATTCTTTCTCCCTCCTCTA No data
Right 1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG No data
1020285867_1020285874 29 Left 1020285867 7:6680100-6680122 CCATTTGCCAACAGGGTGGCAGC No data
Right 1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020285874 Original CRISPR TACCTGGATTTCCTTGCAGC AGG Intergenic
No off target data available for this crispr