ID: 1020287150

View in Genome Browser
Species Human (GRCh38)
Location 7:6692542-6692564
Sequence CTATTTTTCTTGAAGGAACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 474}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020287150 Original CRISPR CTATTTTTCTTGAAGGAACA GGG Exonic
900352828 1:2244403-2244425 GTATTTTTCTAGTAGAAACATGG - Intronic
902890430 1:19439394-19439416 CTTTTGTTCTTGAAGAACCACGG + Intronic
902981366 1:20125839-20125861 CTATTTTTTTTTAAGAGACAGGG - Intergenic
903086861 1:20868935-20868957 GTAATTTTCTTCAAGCAACAGGG + Intronic
904777094 1:32916945-32916967 CTATATTTCTTGTAGGGACAGGG + Intergenic
905593605 1:39186612-39186634 CTATTTTTTTTTAAGAGACAGGG + Intronic
906170406 1:43720220-43720242 CTTTTTTTCTTTAAGAGACAGGG - Intronic
906403808 1:45525424-45525446 CTTTCTTTCTTGCAGGAGCAAGG + Intergenic
906431366 1:45758350-45758372 CTAAATTTCCTGAGGGAACAAGG - Intergenic
906964293 1:50441443-50441465 CTCTTTTGCTTCAAGGAAAAGGG + Exonic
907055484 1:51363343-51363365 TTGGTTTTCTTGAAGGAAAATGG - Intronic
907093241 1:51749317-51749339 TTATTTTTTTTTAAGAAACAGGG + Intronic
907578632 1:55551656-55551678 CTATGTCTTTTGCAGGAACATGG - Intergenic
907664145 1:56419177-56419199 CTATTATTCTTCAAGAGACAAGG - Intergenic
908143123 1:61208706-61208728 CTATTATTCTTGTATTAACAAGG + Intronic
908991163 1:70091499-70091521 CTATATTTTTGGAAGGTACAGGG + Intronic
909665534 1:78128069-78128091 GTATTTTTCTCCAAGGAGCAAGG - Intronic
910332634 1:86092584-86092606 ACATTTTTCTTGAAGGACCTAGG + Intronic
910411061 1:86945119-86945141 GAAGTTCTCTTGAAGGAACATGG + Intronic
911225963 1:95305879-95305901 CTATTTTTCTAGATTGAGCAAGG + Intergenic
911526004 1:98986537-98986559 ATATTTTTGTTAAAGGAATAAGG + Intronic
912213315 1:107578999-107579021 CTACTATTCCTGAAGGAATAAGG + Intronic
912634339 1:111277856-111277878 CTATTTTACTTTTAAGAACAAGG + Intergenic
915550324 1:156629037-156629059 CTTTTTTTTTTTAAGGGACAGGG + Intergenic
915613027 1:157010426-157010448 CTTTTTTTCTTTAAGAGACAGGG + Intronic
916739009 1:167631908-167631930 CCAGTTGTCTTCAAGGAACAGGG + Intronic
916966996 1:169957929-169957951 CTTTTTTTCTTAAAGAGACAGGG + Intronic
917240301 1:172940999-172941021 CTAATTTTTTTGTAGAAACAGGG - Intergenic
917367885 1:174253829-174253851 CTATTTGGCTTCAAGGAGCAAGG + Intronic
918428272 1:184432840-184432862 CTGTCTTTATTGAAGGAAAAGGG + Intronic
919445261 1:197696843-197696865 GTATGTTTCTTGAAGGAAAAGGG - Intronic
921246415 1:213246881-213246903 GTATTTTTCTTTAAGAGACAAGG - Intronic
921277412 1:213533467-213533489 CTGTCTCTCTGGAAGGAACATGG + Intergenic
921837070 1:219789217-219789239 CTATTTTGATAGAAGGAAAATGG + Intronic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923430509 1:233915564-233915586 CTTTTTTTCTTTTAGAAACAAGG - Intronic
924223080 1:241898253-241898275 CTATGTTTCCTGAAGAGACATGG + Intergenic
924587678 1:245374433-245374455 CCACTTTTCAAGAAGGAACAGGG + Intronic
924683376 1:246260731-246260753 CTTTTTTTCAAGAAGGAAAATGG - Intronic
924833439 1:247623314-247623336 CTAGTTTTCTTGATGGAAACTGG + Intergenic
924856613 1:247880860-247880882 GTATTTTTTTTGTAGGAACCAGG - Intergenic
1065903830 10:30230817-30230839 CTCTTTGTCTTGAAGAAATAGGG - Intergenic
1065945521 10:30602511-30602533 TCATTTTTCTTGAAAGAAAAAGG - Intergenic
1066055407 10:31676148-31676170 CTATTTTTCTAGAACTACCAAGG - Intergenic
1066182277 10:32974683-32974705 CTATTTTTTTTGTAGAGACAGGG + Intronic
1068593148 10:58871574-58871596 GTATTTTTTTTGTAGAAACAGGG - Intergenic
1068809014 10:61234785-61234807 CTATTTCTCTTTACGGGACATGG + Intergenic
1068989607 10:63137024-63137046 CAATTTTTCTTTAAGAGACAGGG + Intronic
1070035328 10:72716864-72716886 CTTTCTTTCTTTAAGAAACAGGG - Intronic
1071236258 10:83653049-83653071 ATAATTTTCTTGAAGGAAAAAGG + Intergenic
1072863789 10:99036036-99036058 ATTTTTTTTTTGTAGGAACAGGG - Intronic
1073529011 10:104214419-104214441 CTATTTTTCTCTAAGGAACTGGG - Exonic
1073699016 10:105904099-105904121 CTCTTCTGCTTGCAGGAACATGG - Intergenic
1075285182 10:121178536-121178558 CTTTTTTTGTTGAAGAAACTGGG + Intergenic
1076630454 10:131849140-131849162 CTCTTGTTCTAGAATGAACAAGG + Intergenic
1077705760 11:4483624-4483646 CTTTTTTTCTTGTATGAAGATGG + Intergenic
1078531221 11:12138375-12138397 CTCTTGTTTTTAAAGGAACATGG + Exonic
1078847596 11:15134243-15134265 TTCTTTTTCATGAAGTAACAGGG - Intronic
1078917292 11:15791263-15791285 CTCTTTTTCTGAAAGAAACAGGG - Intergenic
1079047139 11:17115358-17115380 TTTTTTTTCTTGTAGGGACAGGG - Intronic
1080347047 11:31336681-31336703 CTAGTTTTGTAGAAGGAACAAGG - Intronic
1080586027 11:33683354-33683376 CTTTTTTTTTAGAAGGAAGATGG - Intergenic
1080663053 11:34312980-34313002 CTTTTTTTCTTCTAAGAACATGG - Intronic
1081255082 11:40882777-40882799 CTCTTTTTCTTGAAATAAAATGG + Intronic
1081780133 11:45704717-45704739 CAAGTTTGGTTGAAGGAACAGGG - Intergenic
1082229936 11:49751309-49751331 ATATTTTTTTTGTAGAAACAGGG + Intergenic
1082568033 11:54704251-54704273 CTAGTTTTCATGATGGAAGAGGG + Intergenic
1082636521 11:55601241-55601263 ATATTTTTCTTAAAGTTACAAGG + Intergenic
1083988891 11:66234463-66234485 CTGTTCATCTGGAAGGAACAAGG + Intronic
1085142978 11:74165872-74165894 CTAATTTTTTTGTAGAAACAGGG + Intronic
1085553041 11:77393265-77393287 CTTTTTTTTTTTAAAGAACAAGG - Intronic
1085846596 11:80073067-80073089 CTATCTATCTTGAAGGGAGAAGG + Intergenic
1086236210 11:84633994-84634016 CTTTTTTTCTTTAAAGAATATGG - Intronic
1086620124 11:88877646-88877668 ATATTTTTTTTGTAGAAACAGGG - Intronic
1086851276 11:91812101-91812123 CTCTTTTTCCTGATGGATCAGGG - Intergenic
1086971788 11:93089398-93089420 CTATTTTTCAAGAAGGAAATCGG - Intergenic
1087257251 11:95969897-95969919 GTATTTTTTTTGTAGAAACAAGG + Intergenic
1088164352 11:106914863-106914885 CTTTTTTTCTTGTTGGAAGATGG - Intronic
1088762038 11:112940380-112940402 CCATTTGTTTAGAAGGAACAGGG - Intergenic
1089463502 11:118667352-118667374 CTATTTTTTTTGTAGAGACAGGG + Intronic
1089553734 11:119302693-119302715 CTACTTTAGTGGAAGGAACATGG - Exonic
1090687108 11:129134201-129134223 CTCTTTTTTTTTAATGAACAGGG - Intronic
1091067992 11:132535345-132535367 GTCTGTTTCTAGAAGGAACAGGG + Intronic
1091557877 12:1589213-1589235 GTATTTTTTTTGTAGAAACAGGG - Intronic
1091765675 12:3118574-3118596 CTCTTTTTTTTAATGGAACAGGG + Intronic
1092110017 12:5953414-5953436 AAATTTTTCTTCAAGGAAGAGGG - Intronic
1092697778 12:11192578-11192600 TAATTTTTCTTGAATGATCAGGG - Intergenic
1092851031 12:12626861-12626883 CTTTTTTTTTTTAAGAAACAGGG - Intronic
1093725989 12:22509251-22509273 CTATTTCTTTAGAAGGAAAAAGG - Intronic
1094301504 12:28969714-28969736 CCATTTCCCTTGATGGAACATGG - Intergenic
1094710020 12:32952574-32952596 GAATTTTTTTTAAAGGAACAGGG + Intergenic
1094759348 12:33512474-33512496 CTTTTTTTTTTGCAGAAACATGG - Intergenic
1095048802 12:37539250-37539272 CTATTTTTCTAGAATCTACAAGG - Intergenic
1095561215 12:43568045-43568067 CTTTGTTTCATCAAGGAACAAGG - Intergenic
1095764066 12:45874948-45874970 TTATTTTTTTTGTAGGAACAAGG - Intronic
1098050401 12:66446834-66446856 CTATTCATTTTGAAGGAAGATGG - Intronic
1099049189 12:77762847-77762869 CTATTTATATTGAAGCAATATGG + Intergenic
1101823520 12:108202538-108202560 TCATGTTTCTTGCAGGAACATGG + Intronic
1103367276 12:120392502-120392524 ATAATTTTGTTGAAGAAACAGGG + Intergenic
1103417224 12:120750846-120750868 TTTTTTTTCTTTAAGCAACAGGG + Intergenic
1103502761 12:121416502-121416524 GTATTTTTCTAGATGGAAAATGG - Intronic
1103765772 12:123278768-123278790 TTTTTTTTTTTTAAGGAACAGGG + Intergenic
1104240756 12:126986756-126986778 AAATTTTTTTTGCAGGAACATGG + Intergenic
1105628227 13:22134861-22134883 TTATTTTTCATTATGGAACAAGG + Intergenic
1106096923 13:26654526-26654548 GTATATTTCTTCAAGCAACAAGG + Intronic
1106503140 13:30348307-30348329 CTAATTTTTTTGAAGAGACAAGG + Intergenic
1106903941 13:34385389-34385411 CCTTGTTTCTTCAAGGAACAAGG + Intergenic
1107395511 13:40012555-40012577 TTAATTTTCTTGAAGTAACAAGG + Intergenic
1107714811 13:43189573-43189595 CTATTTTTCTTCATGGCACTTGG + Intergenic
1111080776 13:83304328-83304350 ATACTTTTTTTGAAGAAACATGG + Intergenic
1111274632 13:85932739-85932761 CTATGTTTTTTGCAGGAACATGG - Intergenic
1111379921 13:87435910-87435932 GTATTTTTTTTGGAGCAACATGG + Intergenic
1111489883 13:88958622-88958644 CTATTCCTTATGAAGGAACATGG - Intergenic
1112649565 13:101379551-101379573 TCATGTTTCTTGAAGGGACATGG + Intronic
1115007330 14:28501019-28501041 CCATTTTTCTTGAAAGAGAAAGG - Intergenic
1115170692 14:30502795-30502817 TTATTTTTCCTGAAGGCAGAAGG - Intergenic
1115224532 14:31088987-31089009 CTATATTTTTTGGAGGAACGGGG - Intronic
1115308863 14:31959154-31959176 CTTTTTTTTTTGTAGAAACAGGG + Intergenic
1116725125 14:48553675-48553697 CAATGTTTCCTTAAGGAACAAGG + Intergenic
1116765196 14:49062012-49062034 CAATTTTTCTTGATGAAAGATGG + Intergenic
1117892251 14:60438359-60438381 CTATTTTTCTTTAAGTCATATGG - Intronic
1118126790 14:62914162-62914184 CTATTTTTGTGGAAGGCATATGG - Intronic
1118184953 14:63529131-63529153 TTAATTTTCTAGTAGGAACAGGG + Intronic
1118301878 14:64623674-64623696 CTCTTGTTCTTGAAGGCGCAAGG + Intergenic
1118579402 14:67279067-67279089 TTTTTTTTTTTGAAGTAACATGG + Exonic
1118677262 14:68200618-68200640 CAATTTTACTTGAAGGAAGTTGG + Intronic
1118774628 14:68966043-68966065 TTATTTTTTTTGTAGGGACAGGG - Intronic
1118842203 14:69521789-69521811 CTATTTTTCTTGAGGTATCTGGG - Intronic
1118986213 14:70757297-70757319 CTATTTTTTTTGTAGAGACAGGG - Intronic
1119203031 14:72772488-72772510 TTATTTTTCTTTAAGTAATATGG - Intronic
1119417413 14:74482326-74482348 CTCTTTTTCTTCATGGAAAAAGG + Intronic
1119424088 14:74524687-74524709 CTGATTTTCGGGAAGGAACATGG - Intronic
1120705062 14:87736982-87737004 CTTTTTTTCTAAAAGAAACAGGG + Intergenic
1122337031 14:100998777-100998799 TTTTTTTTCTTGATGGACCAAGG - Intergenic
1123146095 14:106131868-106131890 TTATTTTCCTTTCAGGAACATGG + Intergenic
1124069312 15:26376808-26376830 GTTTTTTTCTTGAATAAACATGG - Intergenic
1124130764 15:26983596-26983618 CTATTATTTTTGTAGAAACAAGG - Intronic
1125390603 15:39188674-39188696 CTTTTTTTTTTTAAGAAACATGG + Intergenic
1125634356 15:41174729-41174751 CTATTTTTTTTGTAGAGACACGG - Intergenic
1125962196 15:43840804-43840826 GTATTTTTTTTGTAAGAACAGGG - Intronic
1127139176 15:55956279-55956301 CTTTTCTTCTTTAAGAAACAAGG - Intronic
1127248856 15:57208555-57208577 GTATTTTTTTTGTAGAAACAGGG + Intronic
1127459688 15:59186795-59186817 TTAATTTCCTTGAAGGAATAGGG - Intronic
1128104367 15:65032319-65032341 TTTTTTTTTTTAAAGGAACATGG + Intergenic
1129815008 15:78544175-78544197 CTTTTTTTCTTCAAGGGACATGG + Exonic
1130356556 15:83136827-83136849 AAATTTTTTTTGAAGGAAAATGG + Exonic
1132239491 15:100247057-100247079 GTATTTTTTTTGTAGGGACAGGG + Intronic
1132521951 16:395203-395225 CTATTTTTTTTCAAGAGACAGGG + Intergenic
1133799381 16:9072702-9072724 CTTTTTTGCTTGAAGGGAGAAGG + Intergenic
1133826823 16:9285326-9285348 CTAGTTTTCTAAAAGGTACATGG - Intergenic
1134349236 16:13421090-13421112 ATATTTTTATTGAAGGGAAAGGG - Intergenic
1137581125 16:49634213-49634235 TTTTTTTTTTTTAAGGAACAGGG + Intronic
1138310883 16:56022908-56022930 GTTTCTTTCTGGAAGGAACATGG - Intergenic
1138623715 16:58232382-58232404 CTCTTTTTCCTGAAGTTACAGGG - Intronic
1140060770 16:71567856-71567878 CTTTTTTTCTTGAAAGTACCAGG - Exonic
1140348635 16:74240240-74240262 TTATTTTTTTTTAAGGAAGATGG - Intergenic
1141262973 16:82470423-82470445 TTATTTTCTTTGAAGGAAAAGGG + Intergenic
1141784026 16:86186536-86186558 TTATCTTTCTTGAAGGTAGAAGG + Intergenic
1142324733 16:89407279-89407301 ATATTTTTATATAAGGAACACGG + Intronic
1142879083 17:2870462-2870484 CAAATTTTCTGCAAGGAACAAGG - Intronic
1144406225 17:14955102-14955124 CTATTTTTATTTAAGTAATATGG + Intergenic
1145776377 17:27531885-27531907 CTATTTTTATTTAACAAACAGGG - Intronic
1146175342 17:30662658-30662680 CATTTTTTCTTGTAGAAACAGGG + Intergenic
1146292605 17:31621166-31621188 CTATTTTTTTTGTAGAGACAGGG - Intergenic
1146388449 17:32398707-32398729 TTGTTTTTCTTGAAGTGACAGGG + Intergenic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1148180813 17:45603371-45603393 CTATTTTTTTTGTAGAGACAGGG - Intergenic
1148268090 17:46242555-46242577 CTATTTTTTTTGTAGAGACAGGG + Intergenic
1149261942 17:54889661-54889683 CTATGTTTTTGTAAGGAACATGG + Intergenic
1149545184 17:57498209-57498231 GTATTTTTCTTGCTGCAACAAGG + Intronic
1149950592 17:60980706-60980728 CTATTTTTTTTGCAGAGACAGGG + Intronic
1150260432 17:63785592-63785614 TTTTTTTTTTTTAAGGAACAGGG - Intronic
1150900604 17:69272500-69272522 CTTTTTTTTTTAAAGGAACTTGG - Intronic
1152515858 17:80824509-80824531 TTACTTTTCTTAAAGGAATAAGG - Intronic
1153807568 18:8722384-8722406 CTTTTTTTCTTTAAGAAACAGGG - Intronic
1154957611 18:21274719-21274741 CTAGTTTTCTTGTAGAGACAGGG - Intronic
1154985637 18:21548318-21548340 CTATTTTTTTTGTAGAGACAGGG - Intronic
1155209915 18:23591628-23591650 TTTTTTTTTTTGAAGGAAAAAGG - Intergenic
1155676322 18:28433467-28433489 TTATATTTCTAGAAGTAACATGG - Intergenic
1155949995 18:31901514-31901536 GTGTTTTTCCTGAAAGAACATGG + Intronic
1157045097 18:44093190-44093212 TTATGTTTTTTGAAGCAACATGG - Intergenic
1157771627 18:50352807-50352829 CTAATTTTTTTGTAGGGACAGGG - Intergenic
1158183173 18:54741269-54741291 CTCTTTAGCTTTAAGGAACAGGG - Intronic
1158682954 18:59585117-59585139 CTTTTTGGCTGGAAGGAACATGG - Intronic
1158986406 18:62822084-62822106 ATATTTTGCTTTAAGAAACAGGG - Intronic
1159309339 18:66687386-66687408 GTTTTTTTCTTGAAAGGACAAGG + Intergenic
1160304034 18:77715021-77715043 CTGTCTTTCTTGTTGGAACAAGG + Intergenic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1161655687 19:5513212-5513234 CTAGTTTTTTTGTAGGAACATGG - Intergenic
1161690060 19:5727017-5727039 CTATTTTTTTTGTAGAGACAGGG - Intronic
1162119196 19:8451701-8451723 GTATTTTTTTTGTAGGGACACGG + Intronic
1162266151 19:9576319-9576341 TTTTTTTTTTTGAAGGGACAGGG - Intronic
1163240523 19:16060196-16060218 CTTTTTTTCTTAAAGAGACAGGG - Intergenic
1163629100 19:18407915-18407937 CTATTTTTCTGGTAGAGACAGGG + Intergenic
1163814927 19:19458976-19458998 CCTTTTTTCTTTAAGAAACATGG + Intronic
1167010587 19:46804407-46804429 TTATTTTTATTTAAGGGACAAGG + Intergenic
1167965161 19:53138288-53138310 CTATTTTTTTTGTAGAGACAGGG + Intronic
1168134925 19:54344423-54344445 TTCTTTTTTTTGAGGGAACAAGG + Intergenic
1168451800 19:56472160-56472182 ATAATTTTCTTCAAGGAACTCGG + Exonic
925266476 2:2569946-2569968 CTATTTTCCTGGAAGGAGGAAGG + Intergenic
926131663 2:10306808-10306830 CAATTTTACTTGAAACAACATGG - Intronic
926465988 2:13189175-13189197 CTATTTTTTTTCATGGAAGAAGG - Intergenic
927093284 2:19728591-19728613 ATATTTTTGTTTAAGGAACATGG - Intergenic
927105579 2:19820711-19820733 CTAATTTTTTTGTAGAAACAGGG - Intergenic
927504187 2:23602623-23602645 TTTTTTTTTTTTAAGGAACAAGG + Intronic
928156266 2:28879848-28879870 TTATTTTTCTTGTAGAGACAAGG + Intergenic
928205931 2:29283373-29283395 CCATTCTTCTTGGAGGGACAGGG + Intronic
928354929 2:30603472-30603494 TTTTTTTTTTTGAAGGAAAATGG + Intronic
928499970 2:31881077-31881099 CTTTTTTTCTTGAAGTGCCATGG - Intronic
928841050 2:35605144-35605166 GAATTTTTCTTGTAGGAAGAGGG - Intergenic
929301757 2:40311723-40311745 TTTTTTTTCTGGAATGAACATGG + Intronic
929324710 2:40595298-40595320 CTATTAGTCTTCGAGGAACAAGG - Intronic
929723123 2:44392155-44392177 CTATTTTAATTGAACTAACAGGG + Intronic
930004242 2:46883197-46883219 CTATTTTTCTTCATAGAACTTGG + Intergenic
930940127 2:57002101-57002123 ACATTTTTCATGAAGGAGCAGGG - Intergenic
931800835 2:65756390-65756412 CTATTTTTTTTGTAGAGACAGGG + Intergenic
932511455 2:72297076-72297098 CTTTTCATCTTGAAGGAATAGGG - Intronic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
935151140 2:100437363-100437385 CTATATTTGTTGGATGAACAAGG + Intergenic
936290651 2:111221206-111221228 CTATTGTTCATGTAGCAACATGG - Intergenic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
936986643 2:118317318-118317340 CTATTTGTGTTGAGGGCACAGGG - Intergenic
937795208 2:126009575-126009597 CTTTTTTTCTTTAAGAGACACGG + Intergenic
939538632 2:143464220-143464242 CTATTTTTCTATAAGAAATAAGG + Intronic
939557013 2:143687164-143687186 CTATTTTTCTTAAAGAAAAGAGG + Intronic
939610278 2:144301521-144301543 TTAATTTTCTTGAAGCTACAAGG - Intronic
939738402 2:145878155-145878177 CTTTTTTTTTTGAATGCACAGGG - Intergenic
939811036 2:146832503-146832525 GTATTTTTTTTGTAGAAACAGGG + Intergenic
940396757 2:153198736-153198758 CTGTTTTTCTTGACAGATCAGGG + Intergenic
941151267 2:161918689-161918711 CCAAGTTTCTTAAAGGAACAAGG - Intronic
941352463 2:164453604-164453626 CTATTTTTCTCCAAGGAATAGGG + Intergenic
941499955 2:166261734-166261756 CTATTTTACTTAAGGGTACATGG - Intronic
941833126 2:169984765-169984787 CTTTTTTTCTTCAAGAAACTAGG - Intronic
941931597 2:170946175-170946197 CTAATTTTTTTGTAGAAACAGGG + Intronic
943479459 2:188399676-188399698 TTTTTTTTCTTGTAGGGACAGGG - Intronic
944162067 2:196673365-196673387 CTATTTCTTTTCAAGGAGCAAGG + Intronic
944178148 2:196856769-196856791 CTTTTTTACTTGAAGGATAATGG + Intronic
945175027 2:207035450-207035472 TTATTTTTCTTGTAGAAACAAGG - Intergenic
945611199 2:212005494-212005516 CAAGGTTCCTTGAAGGAACAAGG + Intronic
946841233 2:223822215-223822237 CTATTTTTTTTGTAGAGACAAGG - Intronic
947707832 2:232290896-232290918 GTATTTTTCTTGAAAGACCAAGG + Intronic
948564314 2:238873965-238873987 GTTTTTTCCTTGATGGAACATGG - Intronic
1168826126 20:815491-815513 GTATTGTTCTTGATGGCACATGG - Intergenic
1168982501 20:2019502-2019524 CTTTTTTTCTTGTAGAGACAAGG - Intergenic
1169279304 20:4253616-4253638 CTTTTTTTCTGGTAGGGACAAGG - Intergenic
1169859607 20:10137487-10137509 CTATTTTTCAGGTAGGAAAATGG - Intergenic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1172287111 20:33748538-33748560 GTATTTTTCTTGTAGAGACAGGG + Intronic
1172384608 20:34525122-34525144 TTGTTTTTCTGGAAGGCACAAGG - Intronic
1173452740 20:43179788-43179810 GTATTTTTCTCCAAGAAACAAGG + Intronic
1173900203 20:46582114-46582136 AAATTTTTTTTGTAGGAACAGGG - Intronic
1174625121 20:51907816-51907838 CTATTTTTTTTGTAGAGACAGGG - Intergenic
1174984279 20:55432631-55432653 CTATTTTTGTTGAACTAAGAAGG - Intergenic
1175076698 20:56381093-56381115 TTATTTTTTTTAAAGGGACAGGG - Intronic
1175415818 20:58800351-58800373 CATTTTTCCTGGAAGGAACAGGG + Intergenic
1176211836 20:63927958-63927980 ATATTTGTTTTTAAGGAACAGGG + Intronic
1177166344 21:17609019-17609041 ATATTTTTCTTGAAGTATTAGGG + Exonic
1177770582 21:25510965-25510987 ATCTGTTTATTGAAGGAACAAGG + Intergenic
1178160709 21:29910787-29910809 CTATTTATCCTGAAGGGTCATGG + Intronic
1178586867 21:33878203-33878225 CTATTTTTTTTGTAGAGACAAGG + Intronic
1178730069 21:35093690-35093712 CTATTTATCCTGTAGGGACATGG - Intronic
1179224423 21:39441161-39441183 CTAATTTTTTTTTAGGAACAGGG - Intronic
1179277114 21:39902140-39902162 CTACATGTCTTGAAGGAGCAAGG + Intronic
1179515959 21:41907097-41907119 CTATTTTTGCAGCAGGAACAGGG + Exonic
1179633796 21:42694736-42694758 CTATTTTTCTGGAAGGTAGCAGG - Intronic
1182236458 22:28880834-28880856 CTTTTTTTCTTTTAGAAACAGGG - Intergenic
1182246123 22:28959147-28959169 CCATTTTTCTTGGAGGAAGAAGG + Intronic
1182375704 22:29846161-29846183 GTATTTTTTTTGAAGAGACAGGG - Intergenic
1182597033 22:31429819-31429841 CTATTTTTTTTGTAGAGACAAGG + Intronic
1183717564 22:39542604-39542626 CTTTTTTTTTTGTAGAAACAGGG + Intergenic
1183847910 22:40558090-40558112 CTTTTTTTTTTTAAGGGACAGGG + Intronic
949100038 3:132598-132620 ATATTGTTCTTGAAGGACCTTGG + Intergenic
949141533 3:639400-639422 CTATTTTCCCTGAGGGAATAAGG - Intergenic
951355719 3:21664692-21664714 TTATTTTCCTTGAAGGAGCCTGG + Intronic
952379460 3:32793272-32793294 CTATTTTTCTTGAACCATCTGGG - Intergenic
953010707 3:39022707-39022729 GTATTTTTCTTGTAGGGACAAGG - Intergenic
953221648 3:40977256-40977278 CTATTCTTCCTGAAGCAAGAAGG + Intergenic
954843261 3:53531847-53531869 CTTTTTTTCTTAAAAGAACAAGG + Intronic
955018194 3:55091863-55091885 CTGTTATTCTTGAAAGGACAAGG + Intergenic
956156225 3:66300674-66300696 CTTTTTTTCATGAAGCAAAAAGG - Intronic
956779740 3:72594467-72594489 CTATTTTTTCTGAAGCCACATGG + Intergenic
956953072 3:74304614-74304636 CTTTGTTTCTTGAAGGAGTAAGG + Intronic
957294315 3:78316965-78316987 CTATTTTCCTTTTAGGAACAGGG - Intergenic
957393553 3:79611409-79611431 TTATTTTTCTTTAATGAAAATGG + Intronic
957651894 3:83018184-83018206 CTATTTTTTTGGATGGAAGAGGG - Intergenic
957788508 3:84911093-84911115 GTTTTTTTCTTGCAGGGACATGG + Intergenic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
958847673 3:99284852-99284874 CTGTTTATTTTGAAGGAAAAGGG + Intergenic
959066359 3:101661057-101661079 CTATTTTTTTTGTAGAGACAGGG - Intronic
959279289 3:104317238-104317260 CAATGTTTCTTTAAGGCACAGGG - Intergenic
959831771 3:110871495-110871517 CTTTTTTTCTGGAAGGTAGAGGG + Intergenic
960895426 3:122499748-122499770 TTTTTTTTCTTGAAGAGACAGGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
963374430 3:144445840-144445862 TTTTTTTTTTTTAAGGAACAGGG - Intergenic
963927367 3:150965259-150965281 CTGTTTCTCTTGAAGAAATATGG - Intronic
965013057 3:163121867-163121889 CTCTCTTTCTTCAAGGAAGAGGG + Intergenic
965960183 3:174419891-174419913 CTATTTTTCTGGTAGTAATATGG - Intergenic
966290236 3:178347287-178347309 TTTTTTTTCTTGAAGGAAACTGG - Intergenic
966789645 3:183655451-183655473 CTTTTTTTTCTGTAGGAACAGGG - Intronic
967029440 3:185591906-185591928 GTATTTTTTTTGTAGAAACAGGG + Intronic
968093370 3:195911248-195911270 CTATTTTTTTTGTAGAGACAGGG - Intronic
968848581 4:3062201-3062223 TTATTTTTTTTGTAGGAATAGGG + Intergenic
969250111 4:5962114-5962136 CTGTTTCTCTGGAAGGTACACGG - Intronic
970805713 4:20028898-20028920 CTATTTTTCTTCATGGTACTTGG + Intergenic
971779463 4:31013183-31013205 CTCTTTTTCTTTAGAGAACAGGG - Intronic
971839322 4:31813147-31813169 TTTTTTTTCTTAAAGAAACAAGG - Intergenic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
972577689 4:40367085-40367107 TTATTTTTTTTTAAGAAACAGGG - Intergenic
972652355 4:41030397-41030419 CTTTTTTACTTTAAGGGACAGGG + Intronic
973174989 4:47194781-47194803 CTATGTTTTTTTAAGAAACATGG - Intronic
974155152 4:58062002-58062024 CTATTTTTCTGGAAGAAAATGGG - Intergenic
974620885 4:64352273-64352295 CAATTTCTCTTGAAGAAACTAGG + Intronic
974924779 4:68283476-68283498 CTAATTTTTTTGTAGTAACAGGG - Intergenic
975178765 4:71318826-71318848 TTTTTTTTTTTTAAGGAACATGG + Intronic
975521156 4:75302130-75302152 CTATTTTTTTTAAAAAAACATGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
975816208 4:78218969-78218991 CTATTCTTATAGAGGGAACATGG + Intronic
976698658 4:87945730-87945752 CTCTTTTCCTTGCAGGAAAAAGG + Intergenic
977448556 4:97163608-97163630 CTATTTTACTTGAAGGATCTAGG - Intergenic
978426723 4:108591040-108591062 CTATTTTTCTCAAAAGCACAGGG + Intergenic
978644330 4:110911228-110911250 TTGTTTTTCTTGAAGTAATAGGG + Intergenic
978679974 4:111368445-111368467 TTATTTATCCTGAAGGAAGAAGG + Intergenic
979074995 4:116260056-116260078 CTATTTCACTTCTAGGAACACGG - Intergenic
979075238 4:116262266-116262288 CTATTTTTTTTGCAGGAAATGGG - Intergenic
979514668 4:121594242-121594264 TCATTTTTCTTGAAGAAAAATGG - Intergenic
980432499 4:132722150-132722172 TTATGTTACTTGAAGCAACATGG - Intergenic
980768838 4:137345041-137345063 CTTTTTTTCATTATGGAACAGGG - Intergenic
981215726 4:142164759-142164781 TTATTTTTATTGTAGAAACAGGG + Intronic
981250355 4:142593756-142593778 CTTATTTTCTTAAATGAACATGG - Intronic
981423560 4:144578559-144578581 CAATTTTTTTTCAAGGGACATGG + Intergenic
981577361 4:146218974-146218996 GTATTTTTTTTGTAGGGACAGGG - Intergenic
981982477 4:150810772-150810794 CTATTTTTTTTGTAGAGACAGGG + Intronic
982056558 4:151555269-151555291 GTATGTTTTTTGAAAGAACAAGG - Intronic
983333820 4:166366843-166366865 CTATGTCTTTTGCAGGAACATGG + Intergenic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984406045 4:179331400-179331422 CATTTATTCTTGAAGGAGCAAGG - Intergenic
984518728 4:180774784-180774806 CTAATTTTTTTGTAGGGACAGGG + Intergenic
985526616 5:406269-406291 CTGCATTTCTTGCAGGAACATGG + Intronic
986027684 5:3865894-3865916 CTTTTTTTTTTGTAGGAACAGGG + Intergenic
986416404 5:7532470-7532492 CTTTTCTTCCTGGAGGAACAAGG - Intronic
986909842 5:12542496-12542518 TTATTTCTCATGAAGGAAGATGG + Intergenic
987129810 5:14850010-14850032 CGATTTTGCCTGAAGGAACGAGG - Intronic
987350155 5:17015052-17015074 GTATTTTTTTTGAAGAGACAGGG - Intergenic
987553812 5:19418677-19418699 TTATTTTTCTTCATGTAACAGGG - Intergenic
987778646 5:22402558-22402580 ATATTTTACTATAAGGAACAAGG - Intronic
988153295 5:27415612-27415634 CTATTTTTCTGGCAGGATAAGGG - Intergenic
988629538 5:32913959-32913981 CTTTTTATCTTAAAGGAAAATGG + Intergenic
989564714 5:42890540-42890562 ATATATTTCTTAAAGAAACAGGG + Intergenic
990925686 5:61019576-61019598 CTATTTTTTTTCCAGCAACAAGG + Intronic
991053854 5:62301431-62301453 TTTTTTTTTTTGCAGGAACAAGG + Intergenic
991592476 5:68267640-68267662 CTTTTTTTTTTGGAGGAAGAAGG - Intronic
991706078 5:69360112-69360134 CTATATTTCCTGAAGGAGAATGG + Intronic
991919796 5:71644696-71644718 CTTTTTCTCTTGAAATAACAGGG + Intronic
992217060 5:74536669-74536691 CTATTTTTCTTAGAAGAACTAGG - Intergenic
992928309 5:81614508-81614530 TTATTTTCCTTGGAAGAACAAGG + Intronic
993267792 5:85749948-85749970 TTATTTTTCTGGAAGAAACTGGG + Intergenic
993409851 5:87559779-87559801 GAATTTTTCTTGAAGGGAAAGGG + Intergenic
993462027 5:88194299-88194321 CTATGTTCTTTGAAGCAACATGG - Intronic
993691977 5:91013029-91013051 GTGTTTTTCTTGTGGGAACAAGG - Intronic
994483686 5:100368221-100368243 CTATTTTTTTTGTAGAGACAAGG + Intergenic
996602685 5:125284283-125284305 CTATTTTTCAGGAAGAAAAATGG + Intergenic
996615516 5:125436441-125436463 CTATTTTTCATGGAAGAAGAAGG - Intergenic
996640803 5:125750886-125750908 CTATTTCTTTTGATGCAACATGG + Intergenic
996715818 5:126587310-126587332 ACATTTTTCTTTAAGGAAAATGG - Intronic
996718310 5:126605333-126605355 AAATTTTTCTTTAAGGAACTGGG + Intronic
998237587 5:140412328-140412350 CTATTTTTTTTGTAGTTACAAGG + Intronic
998790668 5:145763309-145763331 CTATAATTTTTTAAGGAACAGGG + Intronic
999059960 5:148623260-148623282 CCATTTTTCCTGAAGGACCTGGG - Intronic
999992213 5:157059970-157059992 CTTTTTTTCCTTAAGAAACAGGG - Intergenic
1001713061 5:173793444-173793466 CTATTTTTATTACAGAAACAGGG - Intergenic
1001979617 5:176030101-176030123 TTATTTTTTTTGTAGAAACAGGG + Intronic
1002208281 5:177579378-177579400 CTAATTTTTTTGTAGGGACAGGG - Intergenic
1002237800 5:177813662-177813684 TTATTTTTTTTGTAGAAACAGGG - Intergenic
1003509498 6:6767753-6767775 TGATTTATCTGGAAGGAACAAGG - Intergenic
1003997528 6:11557914-11557936 CTATTTTTTTTAAAGTGACAGGG + Intronic
1005245997 6:23885800-23885822 CTATCTTTCCTGAAGGAATGTGG - Intergenic
1005336895 6:24806122-24806144 CTATTTTTTTTGTAGAGACAGGG + Exonic
1005849182 6:29806545-29806567 CTCTTTTTCCTGATGGATCAGGG - Intergenic
1005879753 6:30047035-30047057 CTTTTTTTTTTAAAGTAACATGG - Intergenic
1008110680 6:47489980-47490002 TTTTTTTTTTTAAAGGAACAGGG + Intronic
1008799860 6:55353557-55353579 TTATTTTTCTTGAGTGAATAAGG + Intronic
1008925101 6:56883955-56883977 TTAATTTTTTTGAAGAAACATGG - Intronic
1009521928 6:64694248-64694270 CTTTTATCCATGAAGGAACATGG + Intronic
1009539327 6:64932080-64932102 TCATTTTTCTTGAATAAACACGG - Intronic
1009861278 6:69336488-69336510 CTTTTTTTCTTTAAAGAAAAAGG + Intronic
1010098288 6:72072970-72072992 TTATTTTTCTTGGAGAACCAGGG - Intronic
1011124335 6:83990626-83990648 CATTTTTACTTGAATGAACAAGG + Intergenic
1011716465 6:90110651-90110673 TTGTTTTTCTTGAAGTATCAGGG + Intronic
1011767446 6:90638159-90638181 TTATTTTTCTTCAAGAAATAAGG + Intergenic
1011912203 6:92454509-92454531 TTACTTTTCTTGAAGGAAAAGGG + Intergenic
1012157940 6:95843885-95843907 ATATTTTCCTTGTAGGGACATGG + Intergenic
1012240580 6:96867079-96867101 CTTTTTTTCTTGAATGACTAGGG - Intergenic
1012444238 6:99291955-99291977 CTATTTTTTTTTAAGCAAAAGGG - Intronic
1012565475 6:100644122-100644144 CTATTTTTCTTCTAGGTACATGG - Exonic
1012577133 6:100816594-100816616 CTATCTTCTTTGCAGGAACATGG + Intronic
1012587246 6:100938979-100939001 ATATCTTTATTGAAGGACCAGGG - Intergenic
1012619889 6:101330559-101330581 CACTTTGTCTTGAAGGAACCAGG - Intergenic
1013122520 6:107153559-107153581 TTTTTTTTCTTTAAGGAAAAAGG - Exonic
1014668035 6:124263992-124264014 CTGTTTTCCTTGTAGGAAAAAGG + Intronic
1015445858 6:133304062-133304084 ATATTCCACTTGAAGGAACAAGG + Intronic
1016145949 6:140673804-140673826 CTTTTTTTTTTGTAGGGACAGGG + Intergenic
1016863025 6:148740562-148740584 CTATTTTTCCTGAAGTATAATGG - Intergenic
1016961069 6:149673270-149673292 CTATTTTTTTTGTAGAGACACGG + Intronic
1017291367 6:152742489-152742511 CTATTGCTCTTGAAGGAAACAGG - Intergenic
1017938452 6:159028434-159028456 CTATTTTTTGTGAACGTACATGG + Intergenic
1018033145 6:159859812-159859834 ATATTTTTGTTGAAGAAACCTGG + Intergenic
1018964433 6:168473505-168473527 CTTATTCTCTTGAAGGAGCATGG + Intronic
1020048585 7:5063834-5063856 CTATTATGCTTGAAGGAACAAGG - Exonic
1020285181 7:6673347-6673369 CTATTTTTCTTGAAGAAACTGGG - Intergenic
1020287150 7:6692542-6692564 CTATTTTTCTTGAAGGAACAGGG + Exonic
1021024551 7:15648599-15648621 GTATTTTTCCTGAAGCACCATGG - Intronic
1021474234 7:21042654-21042676 CTATCTTTCTTCAAGAAACCTGG - Intergenic
1022998242 7:35780783-35780805 ATATATTTGTTGAAGGAGCAAGG - Intergenic
1023910505 7:44552265-44552287 CTATCTTTCTTGTAGAGACAGGG - Intergenic
1025237123 7:57242110-57242132 CTTTTTTTTTTTAAGAAACATGG - Intergenic
1026676660 7:72434051-72434073 TTTTTTTTCTTTCAGGAACAGGG - Intronic
1026816374 7:73515710-73515732 CTATTTTTTTTGTAGAGACAGGG + Intronic
1026842048 7:73674901-73674923 CCCTTTTGCTTGAAGGTACATGG + Intergenic
1027606662 7:80308375-80308397 CTATTTCTTTGGATGGAACAAGG - Intergenic
1029000467 7:97149104-97149126 CTATTTTTTTTGTAGAGACATGG + Intronic
1029090437 7:98043921-98043943 GTATTTTTTTTGTAGAAACAAGG - Intergenic
1029547848 7:101220292-101220314 GTATTTTTTTTGTAGAAACATGG + Intronic
1030010134 7:105157580-105157602 ATATTTTTCTTAAAGAAAGATGG + Intronic
1030547639 7:110917576-110917598 CTATTTTTGCTGGAGGAGCATGG - Intronic
1030741215 7:113112275-113112297 GTATTTTTCTTGGTGGAATATGG + Intergenic
1031061653 7:117058457-117058479 TTATTTTTCATGAAGGGACATGG + Intronic
1031164798 7:118214930-118214952 ATATGTTTCTTGAAGGTAAAGGG + Intronic
1031760561 7:125708204-125708226 CTATTGTTCTTTATGGAACAGGG - Intergenic
1031880703 7:127195287-127195309 GTAGTTTTCTTTATGGAACATGG + Intronic
1032146179 7:129383170-129383192 CTATTTTTTTTTAAGAGACAGGG + Intronic
1032175060 7:129616588-129616610 CTAGTTTTTTTTAAGAAACACGG - Intronic
1032820700 7:135521659-135521681 GTATTTTTCTTAAAGAGACAGGG - Intergenic
1032998291 7:137474054-137474076 CACTTCTTCTTAAAGGAACAAGG - Intronic
1033176350 7:139127452-139127474 CTTTTCTTCTGGGAGGAACAAGG - Intergenic
1033271125 7:139934037-139934059 ATATTTTCCTGGAAGGAAAATGG - Intronic
1034093290 7:148383634-148383656 CTTTTTTTCTTTTAGAAACAGGG + Exonic
1034144688 7:148858529-148858551 CAATTTTTTTGGAAGGGACAAGG + Intronic
1034164792 7:149017259-149017281 TTAATTTTATTGAATGAACATGG - Intronic
1034686334 7:152974524-152974546 CTATTTACCTTGAAGATACAAGG - Intergenic
1035006679 7:155668344-155668366 CAATTTTTGTTGAAGAAGCAAGG + Intronic
1035698423 8:1619508-1619530 AAATTTTTCTTAAAAGAACAAGG - Intronic
1035855252 8:2967760-2967782 ATATTTTTCTTAAAAGAACATGG + Intronic
1036155650 8:6339724-6339746 CAACTTTTCTGGAAGGAACTTGG - Intergenic
1036581479 8:10079453-10079475 TTATTTTTCTAGAACAAACATGG - Intronic
1036612987 8:10366012-10366034 CTATCTGTCCTGAAGGAGCAGGG - Intronic
1038135375 8:24780176-24780198 CGATTTTTCTTGAGGGTACCTGG + Intergenic
1038793513 8:30690182-30690204 TTATTTTTCTTTAAGAGACAGGG + Intronic
1039199041 8:35066866-35066888 CTATTTTACTGGAAGGAAACAGG - Intergenic
1039267629 8:35842789-35842811 TTATTTTTTTTTAAGGGACAAGG - Intergenic
1039347146 8:36718522-36718544 GTATTTTTCTTGAAATTACAGGG + Intergenic
1039643844 8:39257069-39257091 GTATTGTTATTCAAGGAACATGG - Intronic
1039947655 8:42143823-42143845 CTATTTTTTTTGTAGAGACAGGG - Intergenic
1040028105 8:42800288-42800310 CTCTTTTGCTTGGAGGAAGAAGG + Intergenic
1041120300 8:54579799-54579821 GTATTTAACTTGAAGGAATAAGG - Intergenic
1041170541 8:55137742-55137764 TTATTTTTTTTGTAGAAACAAGG + Intronic
1041577821 8:59420239-59420261 CTATCTCTTTTGCAGGAACATGG + Intergenic
1041795475 8:61743102-61743124 CTATTTTTTTTGTAGAGACAGGG + Intergenic
1041947529 8:63462832-63462854 TTATTTTTCCTGAAGGAAATGGG - Intergenic
1042428001 8:68671822-68671844 CTATTTTCCTTTAACGAAAAGGG + Intronic
1042603900 8:70527267-70527289 CTTTTTTTTTTTAAGAAACAGGG + Intergenic
1042652273 8:71056349-71056371 TTATTTTTCATGAAGGAAAAAGG + Intergenic
1044364676 8:91329920-91329942 GGATTTCTCTAGAAGGAACAGGG - Intronic
1044410664 8:91879082-91879104 TTATTTTTCTTGAAGTAAGTAGG + Intergenic
1044638772 8:94356099-94356121 TTCTTTTTCTTTAAGAAACAAGG - Intergenic
1045565496 8:103310435-103310457 CTATTTTTTTTTAAGAGACAGGG + Intronic
1045611751 8:103851136-103851158 CTTTTCTTCATGAAGTAACATGG + Intronic
1046567524 8:115919990-115920012 CCATTTCTCCTGAAAGAACAGGG + Intergenic
1047293862 8:123553788-123553810 CTATATTTTTTGTAGGGACAGGG + Intergenic
1047770163 8:128024448-128024470 TTATTTTTTTTGTAGAAACAGGG - Intergenic
1047954925 8:129966865-129966887 ATATTTTTTTTGTAGAAACAGGG + Intronic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1050798118 9:9571876-9571898 CTATTTATCTTAAATGCACAAGG + Intronic
1051944022 9:22543997-22544019 CTATTTTCCAGGAAGGAAAAAGG - Intergenic
1052036409 9:23686296-23686318 CTTTTTTTCTTCAAGGTCCAAGG + Intergenic
1052113216 9:24615908-24615930 CTTTTTTTCATGAAGGAAGGAGG - Intergenic
1052148689 9:25084058-25084080 TTATTTTTCTTGAAGAGAAAAGG + Intergenic
1052159519 9:25239381-25239403 CTATTTTTCTTAAAGGGTAATGG + Intergenic
1053223982 9:36335587-36335609 TTATTTTTCCTGAAGAGACAGGG + Intergenic
1054859296 9:69932620-69932642 CTAGTTGTCTTTAAGGAAAAAGG + Intergenic
1055372379 9:75613810-75613832 GTATTTTTTTTGTAGAAACAGGG + Intergenic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056808779 9:89748082-89748104 TCATTTTTGTTGAAGGCACAGGG + Intergenic
1058690334 9:107515021-107515043 ATATTTCTCTTGAATGCACACGG + Intergenic
1060050599 9:120375744-120375766 GTATTTTTTTTGAAGAGACAGGG - Intergenic
1061144926 9:128791960-128791982 CTGACTTTCTTCAAGGAACAGGG - Intronic
1061524050 9:131143179-131143201 GTATTTTTTTTGTAGCAACAGGG + Intronic
1186121684 X:6370327-6370349 CTATTTTACTGGAAGGAAAAAGG - Intergenic
1186302272 X:8213148-8213170 CTATTGTTCTTGAAGGGTCTTGG - Intergenic
1186467481 X:9795117-9795139 CTTTTTTTTTTGAAGAGACAGGG + Intronic
1187565554 X:20446131-20446153 CTAGTTTTCTTCAAGAGACAGGG - Intergenic
1188093985 X:25999662-25999684 TTATTTTTATTGAAGGAAGGTGG + Intergenic
1188311147 X:28618033-28618055 CCATTTTTCTTGAACCTACAGGG + Intronic
1188486942 X:30692438-30692460 TTATTTAATTTGAAGGAACAAGG - Intronic
1189539928 X:41975945-41975967 TTATTTTTCAAGAAGTAACATGG - Intergenic
1189932978 X:46034222-46034244 CTCTTTTTCTTTAAGACACAGGG - Intergenic
1191093161 X:56645921-56645943 GTATATTTTTTGCAGGAACATGG - Intergenic
1191898319 X:66016446-66016468 CTATTTTTCTTTCAGGTACTTGG + Intergenic
1192893596 X:75416591-75416613 CTACTTTTCTAAAAGGAAGAGGG - Intronic
1194480579 X:94417065-94417087 CTACTTTACTTGTAGGAAAATGG + Intergenic
1195253181 X:103067954-103067976 CTATTTTTTTATTAGGAACAGGG - Intergenic
1196310506 X:114158648-114158670 CAATTTTTCTGGAAGTAAAATGG - Intergenic
1196798890 X:119524406-119524428 CTTTTTTTTTTGTAGGGACAGGG - Intergenic
1197104578 X:122699031-122699053 CTAGTTTTTTAGAAAGAACAGGG - Intergenic
1198479638 X:137029885-137029907 CTACATTTCTTAAAGCAACAAGG - Intergenic
1198668222 X:139048028-139048050 TTTTTTTTCTTTAAAGAACATGG + Intronic
1198890382 X:141388441-141388463 ATATTTTTCTTGTAAGAAAACGG - Intergenic
1199003201 X:142664231-142664253 CCATTTTTCTTGAAAAAACAAGG - Intergenic
1201932824 Y:19372839-19372861 TTATATTTCTTGCAGCAACATGG - Intergenic