ID: 1020287869

View in Genome Browser
Species Human (GRCh38)
Location 7:6699478-6699500
Sequence TGGATTCATCTGGCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020287869_1020287884 18 Left 1020287869 7:6699478-6699500 CCCACCCCAGCCAGATGAATCCA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1020287884 7:6699519-6699541 CAGGTGATGAGAACTTCCTGGGG 0: 1
1: 0
2: 1
3: 33
4: 403
1020287869_1020287878 -1 Left 1020287869 7:6699478-6699500 CCCACCCCAGCCAGATGAATCCA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1020287878 7:6699500-6699522 AGGTGCAGGACTGCCCCAGCAGG No data
1020287869_1020287882 16 Left 1020287869 7:6699478-6699500 CCCACCCCAGCCAGATGAATCCA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1020287882 7:6699517-6699539 AGCAGGTGATGAGAACTTCCTGG 0: 1
1: 0
2: 5
3: 69
4: 489
1020287869_1020287883 17 Left 1020287869 7:6699478-6699500 CCCACCCCAGCCAGATGAATCCA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1020287883 7:6699518-6699540 GCAGGTGATGAGAACTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020287869 Original CRISPR TGGATTCATCTGGCTGGGGT GGG (reversed) Intronic
902574134 1:17366606-17366628 TGGATTCCTAGGGCTGGGGAAGG + Intergenic
903653997 1:24937790-24937812 TGGATCCATAGGGCTGGGGATGG + Intronic
905318031 1:37096023-37096045 TGGACTCCCCTGGCTGAGGTAGG - Intergenic
910675826 1:89815690-89815712 TGGATTCATAGGGCTGGGTGTGG - Intronic
911029212 1:93468117-93468139 TGGTTTCCTAGGGCTGGGGTTGG - Intronic
914243219 1:145866719-145866741 AGGCTTCATCAGGCTGTGGTGGG - Exonic
914400905 1:147319053-147319075 AGGATTCCACTGTCTGGGGTTGG - Intergenic
915536925 1:156542157-156542179 TGGATTAATCTGGCTACAGTAGG + Intronic
915553786 1:156650037-156650059 TGGACATATTTGGCTGGGGTTGG + Intronic
917237249 1:172907573-172907595 TGGTGCCATCAGGCTGGGGTGGG + Intergenic
917750667 1:178050423-178050445 TGATGTCCTCTGGCTGGGGTAGG - Intergenic
918162253 1:181912203-181912225 TGGCTTGATCTGGCTGCTGTTGG - Intergenic
919781512 1:201224298-201224320 TGGATTCACATGGCAGGGGGTGG - Intronic
920391888 1:205610174-205610196 TGGGATCTTCTGGATGGGGTCGG - Exonic
920646020 1:207805011-207805033 TGGAGTCATTAGGCTGAGGTGGG - Intergenic
921067498 1:211633092-211633114 TGGCTCCCTCTGGGTGGGGTGGG - Intergenic
921435038 1:215108785-215108807 AGTATTCATCTGTGTGGGGTGGG + Intronic
922925637 1:229344578-229344600 TTGTTTAAGCTGGCTGGGGTTGG + Intergenic
923804319 1:237241921-237241943 TGGTTTCATCTGGCTTTGGCTGG + Intronic
924330759 1:242938295-242938317 TGGATTCAGAAGGCTGAGGTGGG - Intergenic
1063303821 10:4878068-4878090 TGGATACATCTGGATGGATTTGG + Intergenic
1065121968 10:22539031-22539053 TACATTCATCTGTGTGGGGTGGG + Intronic
1066318679 10:34277352-34277374 TAGATTCACCTGGCAGGGGGAGG - Intronic
1066797148 10:39135110-39135132 TGGATTCATCTCACAGAGGTTGG + Intergenic
1067167631 10:43878238-43878260 TGGAGAAATCTGGCTGTGGTGGG + Intergenic
1067361247 10:45581318-45581340 TGGATGCATCAGTCTGTGGTAGG - Intronic
1069120887 10:64567730-64567752 TGGCTTCCTCTGGCTGGGAAAGG + Intergenic
1069830370 10:71279113-71279135 GGGCTGGATCTGGCTGGGGTGGG + Intronic
1070644624 10:78193111-78193133 TGGATGCAACTGGCTGGGGCTGG - Intergenic
1071426863 10:85566031-85566053 TCCATTCATATGGCTGGGGTAGG - Intergenic
1071458381 10:85868683-85868705 TGTGTTCATCTGGCAGGGCTGGG - Intronic
1073534980 10:104268696-104268718 CCGATTCAGCAGGCTGGGGTGGG + Intergenic
1074551476 10:114446498-114446520 TGGATTAATCTGGCTGTGGGAGG + Intronic
1075001521 10:118802287-118802309 GGCATGCATCTGGCTGGGGGGGG - Intergenic
1076730881 10:132438343-132438365 TGGGTGCACCTGGCAGGGGTGGG - Intergenic
1076896454 10:133315135-133315157 AGGATTCAACGGGCTGGGGCAGG - Intronic
1077105550 11:840889-840911 GGGCTTGCTCTGGCTGGGGTGGG - Intronic
1077317788 11:1927055-1927077 TGGATCCACCAGGGTGGGGTGGG + Intronic
1077419472 11:2443919-2443941 TGGATTCCCCTGGGTGGGGGTGG - Intergenic
1078028406 11:7722262-7722284 TTGACTCATATAGCTGGGGTTGG + Intergenic
1079928534 11:26527443-26527465 TGGATTCATGTGGGAGAGGTAGG + Intronic
1080544918 11:33307227-33307249 TGGATGCATCTGGCCGGGCATGG - Intronic
1080795816 11:35562350-35562372 TGGTTTCTTTTGACTGGGGTAGG - Intergenic
1081674493 11:44960577-44960599 TGGATTCACCAGGCTGGGGGAGG - Intergenic
1083729233 11:64643873-64643895 GGGGTTCATCCGGGTGGGGTGGG - Intronic
1083879906 11:65543267-65543289 TGGCTGCCTCAGGCTGGGGTTGG - Intronic
1083915107 11:65737671-65737693 TGGATCCATCTGTCTTGTGTAGG - Intergenic
1084305877 11:68283062-68283084 TGGATTCATCCGGCGGGGTGGGG - Intergenic
1084632582 11:70363802-70363824 TGGATGCTTCTGGCTGGGCATGG - Intronic
1085297613 11:75439801-75439823 AGGGTTCACCTGGCTGGGGTGGG + Intronic
1086370212 11:86148827-86148849 TGGATTCCTCGAGCTGGCGTGGG + Intergenic
1087441446 11:98188695-98188717 TGTTTTAATCTGGCTGGGCTTGG + Intergenic
1089598358 11:119597315-119597337 TGGTTGCCTCTGCCTGGGGTGGG + Intergenic
1092241939 12:6840806-6840828 TGAAATCAGCTGGCAGGGGTGGG - Intronic
1094468830 12:30783308-30783330 TGGACCCATATTGCTGGGGTTGG + Intergenic
1096607734 12:52778523-52778545 TTCATTCATAGGGCTGGGGTGGG - Intergenic
1097239964 12:57568433-57568455 TGGAATCATATGGCTGGGCACGG + Intronic
1097666101 12:62479016-62479038 TAGATTTTTCTGGCTGAGGTAGG + Intronic
1099481302 12:83169816-83169838 AGGATTCATCTGAATGTGGTTGG + Intergenic
1100487234 12:95042129-95042151 TGGCTACCTCTGGGTGGGGTAGG + Intronic
1100684259 12:96969030-96969052 TGGACTGCTCTGGCTGGGTTTGG - Intergenic
1101401074 12:104387410-104387432 TTATTTCATCTGGCTGGGGTTGG + Intergenic
1102354695 12:112222946-112222968 TGCATTCATGAGGCTGGGGAGGG + Intronic
1102617540 12:114167750-114167772 TTGATTCATCTAGCTGAGGCTGG + Intergenic
1103310670 12:120004700-120004722 TTGATTTATCTGGCTAGGATAGG + Intronic
1104801856 12:131559818-131559840 TGGGGTCATGTGACTGGGGTGGG - Intergenic
1104970000 12:132526940-132526962 TGGATCCCTCTGGCTCGAGTGGG - Intronic
1105915458 13:24911473-24911495 TTCATTCATCAGGCAGGGGTTGG + Intronic
1108522488 13:51258844-51258866 TGGGTTCACGTGGCCGGGGTAGG + Intronic
1110331888 13:74282457-74282479 TGGATTCACCCTGCAGGGGTGGG + Intergenic
1111576490 13:90161384-90161406 ACTATTCATCTGGCTGGTGTGGG - Intergenic
1116889888 14:50257951-50257973 GGGAATCATCTGGGAGGGGTTGG + Intronic
1118908934 14:70045489-70045511 CACATTCATGTGGCTGGGGTGGG - Exonic
1119627476 14:76191943-76191965 AGGATACTTCAGGCTGGGGTAGG - Intronic
1119771456 14:77222614-77222636 TGGACTCATGTGGCAGGGATAGG - Intronic
1120033193 14:79665980-79666002 TGGAGTCAACTGGCTAGAGTTGG + Intronic
1120477833 14:85010320-85010342 TGAATTCACATGGCTGGGTTTGG - Intergenic
1120690410 14:87586431-87586453 TGGACTGAGCTGGCTGGGCTGGG - Intergenic
1120868150 14:89313197-89313219 TGGATTCATCTGTTTGTGGCTGG - Intronic
1121010783 14:90518916-90518938 TGGATTCTGGTGCCTGGGGTGGG + Intergenic
1121558193 14:94854391-94854413 TGGATTTCTGTGGGTGGGGTTGG + Intergenic
1122020310 14:98832566-98832588 TGGTTTCCACGGGCTGGGGTGGG - Intergenic
1122453736 14:101833660-101833682 GCAATTCATCTGGCTGGGGGTGG - Intronic
1122906734 14:104805086-104805108 TGGGTTGATGAGGCTGGGGTGGG + Intergenic
1126572562 15:50167895-50167917 TGGATTCATCTGGAGGTGCTCGG + Intronic
1128774614 15:70310000-70310022 TGCCTTAATCTGGGTGGGGTGGG + Intergenic
1128807251 15:70540183-70540205 TGGATTCCTATGGCTGCAGTGGG - Intergenic
1130837327 15:87663737-87663759 TGGATCCATCCGGCTCGGGCTGG + Intergenic
1131629869 15:94165412-94165434 TGGTTTCATTGGTCTGGGGTGGG - Intergenic
1132324403 15:100955961-100955983 TGTTTTTATCTGGCTGTGGTAGG + Intronic
1133343635 16:5055434-5055456 TGCCTTCATCTGCCTGGGTTAGG + Intronic
1134360508 16:13526770-13526792 TGCATTAATCGGTCTGGGGTAGG - Intergenic
1135038052 16:19094751-19094773 TGAATTCAACGGGTTGGGGTAGG + Intergenic
1136397403 16:30000849-30000871 TGCATTCCTCTCGCTGGGGAGGG + Intronic
1138797231 16:59983613-59983635 TGGATTCATTAAGCTGGGGTGGG - Intergenic
1140203503 16:72913937-72913959 CTCATTCATCTGGCTGTGGTGGG - Intronic
1141534851 16:84672121-84672143 TGGATGCTTAGGGCTGGGGTGGG + Intergenic
1141745291 16:85921365-85921387 TGGATCCCTCTGTCTGGGGTGGG + Exonic
1141938489 16:87258296-87258318 TGGATTCTGCTGGCAGGGCTGGG + Intronic
1143277469 17:5722388-5722410 TGATTTCATCTGGCTGTGCTGGG - Intergenic
1143668050 17:8375955-8375977 TGGTTTCAGCTGGCTGTGATTGG - Exonic
1144947731 17:18978328-18978350 GCGGTTCATCTGGCTGGGCTGGG + Exonic
1144958445 17:19031493-19031515 TGGATTCATGGGCCGGGGGTGGG + Intronic
1146127361 17:30239579-30239601 TTGCTTCATCTGGATGGGGTGGG - Intergenic
1146576172 17:33993679-33993701 TGGATACATCTGGATGTGTTTGG + Intronic
1147213589 17:38886369-38886391 TGCCTTCCTCTGCCTGGGGTTGG + Intronic
1147556891 17:41485464-41485486 TGGATTCCACTGGCTGAGTTAGG - Intergenic
1148893976 17:50829327-50829349 TGGATATATTTGGCAGGGGTGGG + Intergenic
1149033045 17:52105039-52105061 TGGTTCCATTAGGCTGGGGTAGG + Intronic
1151129462 17:71881555-71881577 TAGAATCCTCTGGCTGGGTTGGG - Intergenic
1151241755 17:72763885-72763907 TGGGTTCATCTGGATGGAGTGGG - Intronic
1151354667 17:73551270-73551292 TTGATGAATCGGGCTGGGGTGGG - Intronic
1152107628 17:78340399-78340421 CTGATTCATCTGGCTGGGGTGGG - Intergenic
1153845564 18:9046490-9046512 TGGTTACTTCTGGCTGGGGCTGG + Intergenic
1154114407 18:11598643-11598665 TCTATTCAGATGGCTGGGGTGGG - Intergenic
1156621024 18:38851837-38851859 TGTAATGACCTGGCTGGGGTTGG + Intergenic
1157612165 18:48963898-48963920 TGTATTTTTCTTGCTGGGGTGGG - Intergenic
1160610092 18:80077967-80077989 TGAATTCTTCATGCTGGGGTCGG - Intronic
1160920360 19:1516662-1516684 TGGTTTCCCGTGGCTGGGGTGGG + Intergenic
1160978814 19:1807134-1807156 TGGATGCAGCTGCCTGGGGGAGG - Intronic
1161129253 19:2578671-2578693 TGGATCCTTCTCTCTGGGGTGGG + Intronic
1161278932 19:3434646-3434668 TGCATTCTTCTGGGTGGGGAGGG - Intronic
1161509548 19:4662932-4662954 TGGAATCAGCTAGCTGGGGTAGG - Intronic
1163187288 19:15647695-15647717 TGGATTCTTCTGGATGTGGATGG + Intronic
1167277056 19:48545120-48545142 TGGAGTAATCAGGGTGGGGTGGG + Intergenic
1167292120 19:48630130-48630152 TGGAATGTACTGGCTGGGGTAGG + Exonic
925288712 2:2732212-2732234 TGGCTGCGTCTTGCTGGGGTCGG - Intergenic
928082975 2:28326512-28326534 TGGGTGCACCTGGCTGGGCTGGG - Intronic
930155918 2:48107538-48107560 TGGTTCCATCGGTCTGGGGTGGG + Intergenic
934768146 2:96892125-96892147 AGGAGTCATCCGGCCGGGGTGGG + Intronic
935287703 2:101579895-101579917 AGGATCCACCTGGGTGGGGTGGG + Intergenic
936811126 2:116403707-116403729 AGGATTCATCTGGCTGAAGAGGG + Intergenic
939352751 2:141061190-141061212 TGCACTAATCTGTCTGGGGTGGG - Intronic
941888576 2:170554384-170554406 TTGATTCAGCTGGCTGAGGGTGG - Intronic
942397033 2:175561120-175561142 TGGAAGGATCTGGCTGGGGTGGG - Intergenic
945324374 2:208465264-208465286 TGGCTTCATATGGCTGGGCATGG - Intronic
945877244 2:215291303-215291325 TGCATTTTTCTGGCTGGGTTTGG - Intergenic
945889638 2:215414882-215414904 TGCATTCCACTGGATGGGGTGGG + Exonic
946814140 2:223558442-223558464 TTCATTCATCTGGCTGGGTGCGG - Intergenic
947876006 2:233468726-233468748 TGGCTTCCTCTGGTTGTGGTGGG - Intronic
1168837433 20:887058-887080 TGGCTACCTCTGGCTTGGGTGGG + Intronic
1173539706 20:43842342-43842364 TGCATTAATCAGGCTGGGGGTGG + Intergenic
1173653596 20:44683551-44683573 TGGATGCTAGTGGCTGGGGTAGG - Intergenic
1174013031 20:47466009-47466031 TGTATTCCTCAGGCTGGGGTTGG + Intergenic
1175805244 20:61824386-61824408 TTAATTCATGTCGCTGGGGTTGG - Intronic
1179129288 21:38620218-38620240 TGGTTTGATATGGCTGGTGTGGG + Intronic
1179217582 21:39380715-39380737 TGGACTCTTCTGGCTGTGGGTGG + Intronic
1179887652 21:44321235-44321257 TGGATTCACATGGATGTGGTGGG + Intronic
1181601002 22:23951866-23951888 TGGATGGAACTGGCTGGGGGTGG + Intergenic
1181607507 22:23989460-23989482 TGGATGGAACTGGCTGGGGGTGG - Intergenic
1182066000 22:27432075-27432097 TGGCTTCATCTGGCATGGCTGGG - Intergenic
1182277759 22:29201208-29201230 GGGCTTCACCTCGCTGGGGTGGG + Intergenic
1183467703 22:37987920-37987942 GGGATTCTTCAGGTTGGGGTGGG + Intronic
1183677910 22:39310046-39310068 TGGAGTCATGTGGGTGGGGTCGG - Intergenic
951043284 3:18011632-18011654 GGGTTTCATCTGCCTGTGGTTGG + Intronic
953505872 3:43485129-43485151 TGGAGTGATCTGGATGGAGTGGG + Intronic
953535348 3:43773177-43773199 GAGATTCATCTGGCAGGGGAGGG + Intergenic
953628683 3:44592761-44592783 TGGATCCAACTGGCTGGGCGCGG + Intronic
955968227 3:64410656-64410678 TGAATTCCTCTGGTTGGGGAGGG - Intronic
956291489 3:67664904-67664926 TTTATTCATCTAGCTGAGGTTGG + Intergenic
960587041 3:119329658-119329680 TGGATACAGCTGGCTGGGGGTGG - Intronic
962071001 3:132034103-132034125 TGGCTTGACCTGGCTGCGGTTGG - Intronic
962237321 3:133717703-133717725 TGGATTGAGGCGGCTGGGGTGGG + Intergenic
962381760 3:134903881-134903903 TGGGCACATCTGGCTGCGGTGGG - Intronic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
968906411 4:3454007-3454029 TTGAGTCATTTGGCTGGGGAAGG + Intergenic
975254493 4:72216899-72216921 TGGGTTCATTTGTGTGGGGTTGG - Intergenic
975376383 4:73651250-73651272 GGGCTTCATTTTGCTGGGGTGGG - Intergenic
976107846 4:81639176-81639198 TGGTTTCCTAGGGCTGGGGTCGG + Intronic
976338092 4:83913786-83913808 TGGATTCAGATGGGTAGGGTAGG + Intergenic
976574951 4:86658117-86658139 TGGGTTCTTCTCGCTGGAGTTGG + Intronic
978290566 4:107134040-107134062 TGGATTAGTCAGGGTGGGGTAGG + Intronic
978777421 4:112516976-112516998 TGGATTCATTTGGTTAGGGGAGG + Intergenic
981654193 4:147093269-147093291 TGGAATCATCTGGGTGGTGAGGG + Intergenic
984958188 4:185066792-185066814 TGGTTGCCTGTGGCTGGGGTAGG + Intergenic
985673020 5:1216044-1216066 TGGAGTGAGCTGGCTGGGTTGGG + Intronic
988812930 5:34803018-34803040 TGGATTCCTCAGCCTGTGGTGGG + Intronic
990140793 5:52701611-52701633 TTGATTCACCAGGTTGGGGTTGG - Intergenic
990282179 5:54262981-54263003 TGAATTCATTTGGATGGGGTGGG + Intronic
995155050 5:108901081-108901103 TGGTTTCACATGGCGGGGGTGGG - Intronic
995183081 5:109246996-109247018 TGGATTCACCCTGGTGGGGTTGG + Intergenic
997721057 5:136078792-136078814 CTGATTCAGCTGTCTGGGGTGGG + Intergenic
997884994 5:137621999-137622021 TGGATTCAACTTGCTTGGGAGGG - Exonic
998964324 5:147522602-147522624 TGAATTCATCTTGCTGTGGCGGG + Intergenic
1004937367 6:20520770-20520792 TAGACTTATCTGGCTGGGGGCGG - Intergenic
1006293776 6:33160792-33160814 TGGAGGCTTCTGGGTGGGGTGGG - Intergenic
1006523524 6:34585908-34585930 TGGATTCTGCGGGGTGGGGTGGG + Intergenic
1006874887 6:37286603-37286625 GGGAATCATCTGGCTGGGTGCGG - Intronic
1007459912 6:42010402-42010424 TGGCTTCATGTGGCTGGGTTGGG + Intronic
1007481389 6:42152564-42152586 TGGTTGCCTTTGGCTGGGGTGGG + Intergenic
1009324970 6:62338509-62338531 TGAAGTCATCAGGCAGGGGTAGG - Intergenic
1011332985 6:86230763-86230785 TGGATTCATTTGAGTAGGGTTGG + Intergenic
1012366716 6:98449750-98449772 TGGATGCCTGAGGCTGGGGTTGG - Intergenic
1013248977 6:108315505-108315527 TTGATTCAGAGGGCTGGGGTAGG + Intronic
1013249526 6:108320506-108320528 TGGATCCATTTGGTAGGGGTTGG + Intronic
1016035628 6:139380066-139380088 TTGATTCATCAGGCTGGGAGTGG + Intergenic
1018719782 6:166563603-166563625 TGGCTCCCTCTGGCTGGAGTTGG - Intronic
1018986878 6:168644440-168644462 TCTTTTCATCTGGCTGGGGAGGG - Intronic
1019380078 7:716797-716819 TGAATGCAGCTGGCTGGGGAAGG - Intronic
1019911364 7:4102287-4102309 AGGTTTCATTTGGCTGTGGTGGG + Intronic
1020287869 7:6699478-6699500 TGGATTCATCTGGCTGGGGTGGG - Intronic
1022360333 7:29650731-29650753 CCGCTTCAACTGGCTGGGGTGGG - Intergenic
1023090072 7:36609093-36609115 GTGAGTCATCTGGCTGGGGTAGG + Intronic
1023093745 7:36640068-36640090 TGGGTTCATCTGGATGTGGCTGG + Intronic
1024307206 7:47938790-47938812 TGGAGTCACCTGGGTGGGGTGGG + Intronic
1026537948 7:71255846-71255868 TCCATTCATGTGGCTGGGGGAGG - Intronic
1027903429 7:84148713-84148735 GGGATTCATCTTGCTGTGTTAGG - Intronic
1028294813 7:89115421-89115443 AGGATGCATCTCCCTGGGGTGGG - Intronic
1028430036 7:90736056-90736078 TGGCTTCACTTGGCTGGGGGAGG + Intronic
1031584505 7:123518318-123518340 TGGATTTTTTTGGCAGGGGTTGG - Intronic
1033172293 7:139094775-139094797 TGGCTTCATCTTACTGCGGTGGG + Intronic
1038535263 8:28349038-28349060 TGACTTCATCTGGGTGGGGTCGG + Intronic
1044521793 8:93207105-93207127 GGGATGCATGTGGCTGGGGCTGG + Intergenic
1045610337 8:103833351-103833373 TGGATTTATTTTGCTTGGGTTGG + Intronic
1045702573 8:104883641-104883663 TGGATTAGTCAGGATGGGGTAGG + Intronic
1047833256 8:128659055-128659077 AGAATTCATCTGGCTGCTGTTGG + Intergenic
1047974217 8:130113234-130113256 TGCATTCACCTGGCTGGGTGGGG - Intronic
1050533364 9:6609624-6609646 TGGATAGATGTGGCTGGGGGTGG - Intronic
1052144114 9:25026099-25026121 TGGCTTCCTTTGGCTGGGGAAGG + Intergenic
1053361049 9:37486775-37486797 TTGATTCCTCTTCCTGGGGTTGG - Exonic
1054849320 9:69830266-69830288 TGGAGTCATCTGGCTAGGCAAGG + Intronic
1055706464 9:79010582-79010604 TGGCTTCACTTGGCTGGGCTGGG + Intergenic
1058904871 9:109474490-109474512 TGGATCCACCAGGGTGGGGTGGG + Intronic
1059545217 9:115169053-115169075 TGGATCCCTCAGGGTGGGGTGGG - Intronic
1059900677 9:118921748-118921770 TGCACTCCACTGGCTGGGGTTGG + Intergenic
1060025688 9:120169066-120169088 TTGAGTCATGTGGCTGAGGTTGG + Intergenic
1060127294 9:121060665-121060687 TAGAGTCAGCTGGGTGGGGTGGG - Intergenic
1060554779 9:124502723-124502745 TGGCCTCTGCTGGCTGGGGTTGG + Intronic
1060812259 9:126616391-126616413 TGGATTTGTATGGCCGGGGTTGG + Intronic
1061732844 9:132629837-132629859 TGGGTTCATCTTCCTGGGGGAGG + Intronic
1062122274 9:134840130-134840152 TGACTCCGTCTGGCTGGGGTGGG - Intronic
1185661618 X:1733112-1733134 AGGATGCATCTGGCTGGGCATGG - Intergenic
1186567641 X:10680912-10680934 TGTATTCAGCAGGCTGAGGTGGG + Intronic
1187258836 X:17666696-17666718 TGGATTCATCAGGATAGGATAGG + Intronic
1189122216 X:38407174-38407196 TCCATTCATCTGTCTGGAGTTGG + Intronic
1189260512 X:39675328-39675350 TGGACTCACCTTGCTGGTGTGGG - Intergenic
1194040657 X:88938374-88938396 TGGATTGATCAGCCTAGGGTGGG + Intergenic
1194622955 X:96196138-96196160 TTGCTTCCTTTGGCTGGGGTTGG - Intergenic
1196597612 X:117563578-117563600 TGTTTTCATCTGGCTAGGGAAGG - Intergenic
1199596576 X:149510742-149510764 TGCATTCATCTGAATGGAGTGGG + Intronic
1199872836 X:151913619-151913641 TGGGGTCATCTATCTGGGGTGGG - Intronic
1201228111 Y:11837419-11837441 TGGATTCAGAAGGCTGAGGTGGG - Intergenic