ID: 1020288773

View in Genome Browser
Species Human (GRCh38)
Location 7:6706630-6706652
Sequence GGCTCACCGTCCTGCGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3575
Summary {0: 1, 1: 0, 2: 0, 3: 58, 4: 3516}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020288763_1020288773 2 Left 1020288763 7:6706605-6706627 CCGGAGCCCAGATCCGTCTCCCT 0: 1
1: 0
2: 3
3: 21
4: 221
Right 1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG 0: 1
1: 0
2: 0
3: 58
4: 3516
1020288762_1020288773 3 Left 1020288762 7:6706604-6706626 CCCGGAGCCCAGATCCGTCTCCC 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG 0: 1
1: 0
2: 0
3: 58
4: 3516
1020288768_1020288773 -5 Left 1020288768 7:6706612-6706634 CCAGATCCGTCTCCCTGGGGCTC 0: 1
1: 5
2: 3
3: 15
4: 409
Right 1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG 0: 1
1: 0
2: 0
3: 58
4: 3516
1020288760_1020288773 7 Left 1020288760 7:6706600-6706622 CCCTCCCGGAGCCCAGATCCGTC 0: 1
1: 0
2: 2
3: 13
4: 133
Right 1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG 0: 1
1: 0
2: 0
3: 58
4: 3516
1020288767_1020288773 -4 Left 1020288767 7:6706611-6706633 CCCAGATCCGTCTCCCTGGGGCT 0: 1
1: 6
2: 2
3: 11
4: 154
Right 1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG 0: 1
1: 0
2: 0
3: 58
4: 3516
1020288761_1020288773 6 Left 1020288761 7:6706601-6706623 CCTCCCGGAGCCCAGATCCGTCT 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG 0: 1
1: 0
2: 0
3: 58
4: 3516
1020288759_1020288773 20 Left 1020288759 7:6706587-6706609 CCAGGCGGGGCGTCCCTCCCGGA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG 0: 1
1: 0
2: 0
3: 58
4: 3516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020288773 Original CRISPR GGCTCACCGTCCTGCGGAGC CGG Exonic
Too many off-targets to display for this crispr