ID: 1020293437

View in Genome Browser
Species Human (GRCh38)
Location 7:6740183-6740205
Sequence GACGTTTTCTGGTTCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020293437_1020293442 29 Left 1020293437 7:6740183-6740205 CCAGGTGAGAACCAGAAAACGTC No data
Right 1020293442 7:6740235-6740257 TCGTCACCGCGCTGATACTGCGG 0: 1
1: 1
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020293437 Original CRISPR GACGTTTTCTGGTTCTCACC TGG (reversed) Intergenic
No off target data available for this crispr