ID: 1020293442

View in Genome Browser
Species Human (GRCh38)
Location 7:6740235-6740257
Sequence TCGTCACCGCGCTGATACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 8}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020293437_1020293442 29 Left 1020293437 7:6740183-6740205 CCAGGTGAGAACCAGAAAACGTC No data
Right 1020293442 7:6740235-6740257 TCGTCACCGCGCTGATACTGCGG 0: 1
1: 1
2: 0
3: 1
4: 8
1020293439_1020293442 18 Left 1020293439 7:6740194-6740216 CCAGAAAACGTCCATGGCTGCTT No data
Right 1020293442 7:6740235-6740257 TCGTCACCGCGCTGATACTGCGG 0: 1
1: 1
2: 0
3: 1
4: 8
1020293440_1020293442 7 Left 1020293440 7:6740205-6740227 CCATGGCTGCTTTAACAGAGCCA No data
Right 1020293442 7:6740235-6740257 TCGTCACCGCGCTGATACTGCGG 0: 1
1: 1
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020293442 Original CRISPR TCGTCACCGCGCTGATACTG CGG Intergenic
903703392 1:25267460-25267482 GGGTCACCGCGCCGAGACTGGGG + Intronic
903712659 1:25337789-25337811 GGGTCACCGCGCCGAGACTGGGG + Intronic
905241723 1:36585909-36585931 TCGTCACCGCGCTGAGGCTCCGG - Intergenic
919640874 1:200042416-200042438 TCATCACTGCGGCGATACTGTGG + Intronic
1111060908 13:83017447-83017469 TTGTCACCGAGCTGGTGCTGTGG + Intergenic
1132688494 16:1172093-1172115 ACGTCACCGGGATGATGCTGGGG + Intronic
1162648183 19:12065089-12065111 TCGTCGCCGCGCGGCGACTGCGG + Intronic
1162884409 19:13685669-13685691 TCCCCACCACACTGATACTGGGG + Intergenic
1020189476 7:5984420-5984442 TCATCACCGCGCTGATACTGCGG - Intronic
1020293442 7:6740235-6740257 TCGTCACCGCGCTGATACTGCGG + Intergenic
1035131031 7:156653721-156653743 TCGGCATCGAGCTGATAGTGCGG - Intronic