ID: 1020298583

View in Genome Browser
Species Human (GRCh38)
Location 7:6777355-6777377
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 2, 1: 0, 2: 17, 3: 35, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020298583_1020298585 -6 Left 1020298583 7:6777355-6777377 CCTACCTTCATCTGTTTTTACAG 0: 2
1: 0
2: 17
3: 35
4: 272
Right 1020298585 7:6777372-6777394 TTACAGCCATTCCCCATCGCTGG 0: 3
1: 5
2: 23
3: 53
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020298583 Original CRISPR CTGTAAAAACAGATGAAGGT AGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
902530032 1:17085118-17085140 GGGCAAAAACAGAGGAAGGTGGG - Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905574672 1:39034311-39034333 CTGGAAAAACAGATCAATTTTGG - Intronic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911871692 1:103107884-103107906 CTGGAGAAAGAGATGAATGTAGG - Intronic
914325276 1:146608319-146608341 TTGTCAGAACAGCTGAAGGTCGG + Intergenic
916683808 1:167126911-167126933 CTGAAACACCAGAAGAAGGTGGG + Exonic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917420396 1:174857126-174857148 CTGTAAAAGCAGACGACAGTGGG - Intronic
917731415 1:177878682-177878704 CAGGAAAAAGAAATGAAGGTGGG + Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
919226480 1:194710336-194710358 CTGTAACAAGATATGATGGTAGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
924296818 1:242595887-242595909 GTGTAAAAACAGTAGAATGTGGG + Intergenic
1063182362 10:3615859-3615881 TTTTAAAACCAAATGAAGGTTGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064698378 10:17990783-17990805 TTGTACAAACAGATGCAGATTGG + Intronic
1067663984 10:48257578-48257600 CTCTAAAAAAAGGTAAAGGTTGG - Intronic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1069176329 10:65293381-65293403 CTGTAACAATAGCTGAATGTTGG + Intergenic
1071978906 10:90983766-90983788 ATGTAAATACCTATGAAGGTGGG + Intergenic
1072677103 10:97475796-97475818 AAGTAAAAACAGAAGAATGTGGG + Intronic
1073177724 10:101566637-101566659 CTGTAATAACAGAAGATGGATGG + Intergenic
1074050572 10:109877673-109877695 CTCAACAGACAGATGAAGGTGGG + Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1078224910 11:9383267-9383289 CTCTAAAAAAAGAGGGAGGTGGG - Intergenic
1078463404 11:11532322-11532344 TTGTAAAAAGAGATGAACGATGG - Intronic
1078688200 11:13552418-13552440 CTTTAAAAACAAGTGAAGGAGGG + Intergenic
1081255821 11:40893171-40893193 CTTTAAAAACTCATGAAGATAGG + Intronic
1081716839 11:45256464-45256486 ATGCAAAAACAGGTGGAGGTAGG - Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1083570277 11:63757074-63757096 ATGTGAAAATAAATGAAGGTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084682378 11:70673878-70673900 TTGTAAAAACAGTTAAAAGTAGG + Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1087779642 11:102288621-102288643 CTGCTACAACAGATGGAGGTCGG - Intergenic
1089047373 11:115514339-115514361 TTGTAAAGAAAGATGAAGGCAGG - Intergenic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1092130984 12:6113182-6113204 CTGTAAAAACTGTTCTAGGTGGG - Intronic
1095241234 12:39861204-39861226 CTGTAATAGAAGATGAAGTTGGG - Intronic
1096246081 12:49987603-49987625 CTGTTAAAGAAGTTGAAGGTGGG + Intronic
1096769481 12:53925605-53925627 CTGAAACAACAGATAAGGGTCGG + Intergenic
1097930986 12:65185960-65185982 TGGTAGAGACAGATGAAGGTTGG + Intronic
1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG + Intergenic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1102534780 12:113573277-113573299 CTGTAAAATCTGAATAAGGTGGG + Intergenic
1102954611 12:117051442-117051464 CTGTGAAAACACATAAAGATGGG - Intronic
1103001862 12:117390879-117390901 CTATGAAAACAGACCAAGGTTGG - Intronic
1103386589 12:120537328-120537350 CTGTAAAAACTCATGTAGGCCGG + Intronic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1107775829 13:43840077-43840099 CTGTAACAACAGCTGAGTGTTGG - Intronic
1108107897 13:47032926-47032948 CTGTGAGAACAGAAAAAGGTGGG - Intergenic
1108558834 13:51623221-51623243 CTAAAAAAAAAAATGAAGGTAGG + Intronic
1110319149 13:74140749-74140771 CTGTGATAAGAAATGAAGGTTGG + Intergenic
1111263683 13:85778145-85778167 CTGTAAAAACAGTTGAGTGAGGG + Intergenic
1111961857 13:94820047-94820069 CTGTAAGACAAGATGAAGATGGG - Intergenic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113980925 13:114274855-114274877 CTTTAAAAACAGAAAAAGTTTGG - Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115193174 14:30768891-30768913 CTGAACAAACAGATGAACTTTGG + Intergenic
1116082159 14:40187901-40187923 GTGTAAAAATAGATGTAGGTCGG - Intergenic
1117419359 14:55528889-55528911 CTGAAAAATCACATGAAGATTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1121073672 14:91048678-91048700 CTGAAAAACAAGATGAATGTAGG + Intronic
1124081647 15:26504276-26504298 CTGTCAAAACAGTGGAAGGCAGG - Intergenic
1124162100 15:27281345-27281367 CTGGAAAAACAGGCAAAGGTGGG - Intronic
1125122833 15:36183111-36183133 CTGTAACCAGAGAGGAAGGTAGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1126411056 15:48373555-48373577 CTGTAAAGACTGATCATGGTTGG + Intergenic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128652201 15:69425557-69425579 CTGTATGACAAGATGAAGGTTGG - Intronic
1129943854 15:79522383-79522405 CTGGAAAAACAATAGAAGGTGGG - Intergenic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1130843464 15:87723313-87723335 CTGTGACAACAGGTGAGGGTTGG - Intergenic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131211879 15:90504632-90504654 CTTTAAAAATGAATGAAGGTGGG - Intergenic
1132227718 15:100155462-100155484 CTGTGAAAACACATGACTGTGGG - Intronic
1132580522 16:682671-682693 CTGGAAAAGCAGGTGAGGGTGGG + Exonic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135561586 16:23480704-23480726 CTGTACAAACAGGTGATGGAGGG - Exonic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1139001933 16:62521348-62521370 CTGTAATAACAGCTGAATGTTGG + Intergenic
1139747638 16:69087331-69087353 CTGAAAAAGCAGTTGAAGCTTGG - Intergenic
1140008287 16:71102628-71102650 TTGTCAGAACAGCTGAAGGTCGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142085266 16:88176627-88176649 ATGAAAAAAAAAATGAAGGTGGG + Intergenic
1142267607 16:89071697-89071719 CTGTAAAATGGGATGAACGTTGG - Intergenic
1143611397 17:8019897-8019919 GTGTAAACACATCTGAAGGTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146496182 17:33324552-33324574 CTGTACACACAGATCTAGGTAGG - Intronic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1147173900 17:38639646-38639668 CTGTTAAAGAAGTTGAAGGTCGG + Intergenic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1148968440 17:51457870-51457892 TTATAAAAAGACATGAAGGTCGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151948626 17:77333797-77333819 CTTTAAAAAAAAATGAAGTTTGG - Intronic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1153366960 18:4267469-4267491 TTGTTAAAACAAATGGAGGTGGG - Intronic
1153439408 18:5100297-5100319 CTGGCAAAACAGATTAAGGGAGG + Intergenic
1153700959 18:7692690-7692712 CAGTGAAAACAGAGGAAGATAGG - Intronic
1155181002 18:23346414-23346436 CTATAAAAATAGTTGAAGGCAGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155445693 18:25910976-25910998 CCATAAATACAGATCAAGGTGGG + Intergenic
1155844487 18:30688516-30688538 TTGTGAAAACTGATGAATGTTGG - Intergenic
1156068548 18:33175556-33175578 GTTCAAAAACAGATGAAAGTAGG - Intronic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1160109850 18:76015928-76015950 CTGTAAAAGCAAATGAAAGCAGG + Intergenic
1161920046 19:7259191-7259213 CTGTAAAAAGAAAGGAAGGAAGG - Intronic
1164473243 19:28553223-28553245 CTGGCACAGCAGATGAAGGTAGG - Intergenic
1166132359 19:40753691-40753713 CTCTAAAAACATATGCAGGCCGG - Intronic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
1166847810 19:45740452-45740474 CTATTAAAACAAATGAAGGCCGG + Intronic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
927058967 2:19395942-19395964 GTGCAATAACAGATGAAGATGGG + Intergenic
928531390 2:32196016-32196038 CTTTAAAAAAAAATGAAGGCTGG + Intronic
928765658 2:34642205-34642227 CTGTGCAATCAGATGATGGTAGG - Intergenic
930301191 2:49618101-49618123 CTGACAAAACAGATGAAGACAGG + Intergenic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
936760666 2:115777031-115777053 CTATAAACACAGATCAAGGCAGG - Intronic
937744314 2:125393173-125393195 ATGCAAACACATATGAAGGTTGG + Intergenic
938041215 2:128077811-128077833 CTGAAACAAGAGATGAAGATTGG - Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939437865 2:142201864-142201886 CTGAGATAATAGATGAAGGTGGG + Intergenic
939656998 2:144838214-144838236 CTTTAGAAGCAGATTAAGGTAGG + Intergenic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
940194778 2:151081537-151081559 ACGTAAAAACAAATGAAGTTTGG + Intergenic
940591205 2:155730147-155730169 CTGTAGAAACAGATGCTGATAGG + Intergenic
941699071 2:168584611-168584633 CTGTCAAAACAGATAATAGTGGG + Intronic
942374408 2:175322368-175322390 ATTTAAAAACAGATAAAAGTTGG - Intergenic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
942556659 2:177178449-177178471 CTGGAAAAGCAGGTGAGGGTGGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943293173 2:186101877-186101899 CTGTAAAATCAAATGAACTTTGG - Intergenic
943814006 2:192228206-192228228 TTGTAAAAACAGAAGAAATTTGG + Intergenic
943850040 2:192708189-192708211 CTGTAGAAAAAGATAAAGGTAGG + Intergenic
945377992 2:209101822-209101844 TTGTAGAAACAGATGAATTTAGG + Intergenic
945457182 2:210063761-210063783 CTGTAAAATCAAAAGCAGGTTGG - Intronic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
1170372544 20:15665269-15665291 CTTTTAAAACAAATGAAAGTAGG - Intronic
1171131360 20:22656711-22656733 CTTTAGAGACTGATGAAGGTTGG + Intergenic
1174708666 20:52682838-52682860 CTGAAAAAGCAGTTGCAGGTGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1177551071 21:22623256-22623278 TTGAGAAAGCAGATGAAGGTGGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1180208876 21:46281523-46281545 CTGTAAAAACAAAAGGGGGTTGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
949966261 3:9359057-9359079 CTGGCAAAACAGATTATGGTGGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951201546 3:19880729-19880751 TTATTAAAACAGATGAAGGCGGG + Intronic
952119741 3:30228021-30228043 CTATAAAAGCAGAAGAAAGTAGG - Intergenic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
953005738 3:38977636-38977658 CTGGAAAGGCAGGTGAAGGTAGG - Intergenic
955780540 3:62479454-62479476 CTATAGAAACAGATGAGAGTGGG + Intronic
957502055 3:81069775-81069797 TTATAAAAGCAGATGAAGGATGG - Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
959854737 3:111138380-111138402 TTTTAAAAACAGATGAAAGTTGG - Intronic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
962296100 3:134188832-134188854 TTGTCAAAACAGTTAAAGGTAGG - Exonic
962650646 3:137485904-137485926 CTGTAAAAAATGATGTTGGTTGG + Intergenic
963897117 3:150698822-150698844 CAGTACAAACAGAAGAAAGTTGG - Exonic
964127965 3:153256376-153256398 CTGGAAGAAAAGATGAGGGTGGG - Intergenic
966984585 3:185167551-185167573 CTGTAAAAAAAAAAAAAGGTAGG - Intergenic
967796061 3:193600016-193600038 CTGTAATAACAGCTGAGTGTTGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971980474 4:33743742-33743764 CTGTAAATTCAGATGTTGGTTGG - Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
972947439 4:44273539-44273561 CTGGGAAAAAAGATGAAGATGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974000931 4:56509966-56509988 TTTTAAAAACAGATGAACTTGGG - Intronic
974102291 4:57430285-57430307 CTGTATTAACTGATGATGGTGGG + Intergenic
974386593 4:61207955-61207977 CTGTAAAAAGATAGGCAGGTTGG + Intronic
975078688 4:70247304-70247326 CTATAAAAACAAATGAAAGATGG + Intronic
976570647 4:86605336-86605358 GTTTCAAAACAGATGAAAGTTGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979132166 4:117060804-117060826 CTGTGCAAACAGAATAAGGTAGG + Intergenic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981200814 4:141977645-141977667 CTGTAACAATAGCTGAATGTTGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982980238 4:162124491-162124513 CTTTAAGAACAGAGGAAGGGAGG - Intronic
983165230 4:164468139-164468161 TTGAAAAAAGAGATGAAGGATGG + Intergenic
983889587 4:173016649-173016671 CTGTAAAATCAAATGCAAGTTGG - Intronic
984248998 4:177309650-177309672 CTGTAAAAGCAGAAGAAATTGGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
986601319 5:9475910-9475932 CTGTAAAATGAGTTGAAGTTTGG - Intronic
988005311 5:25402867-25402889 CTCTAAAAACAGCTCAAGCTAGG - Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989803133 5:45569659-45569681 TTGTAAAAACAGATAAAGACTGG - Intronic
990054573 5:51556121-51556143 TTGTAAAAACAGAATAAAGTGGG + Intergenic
990356914 5:54976717-54976739 CAATAAAATCAGATGAAAGTGGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
991146080 5:63306068-63306090 CTGTAAAAACAGGTGTAGACAGG + Intergenic
992160861 5:74000192-74000214 TTGTAAAGAGAGATGAAGGCTGG - Intergenic
992237260 5:74723712-74723734 CTGTAGTACCAGATGAAGGCAGG - Intronic
992728881 5:79638092-79638114 ATGTAAGAACAGAAGAAGGCTGG - Intronic
993284271 5:85970369-85970391 CAGTAAAAAAAGATAAAGGAGGG - Intergenic
993292745 5:86096012-86096034 GTGTAAAAACAGGTGAAGGGTGG + Intergenic
993572391 5:89557606-89557628 CTGGTAAAAAAGATGATGGTGGG + Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994818487 5:104616192-104616214 CTGTGAAAACTGCTAAAGGTGGG - Intergenic
996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG + Intergenic
1000950954 5:167482483-167482505 CTGTAAAAAAATCTGAAGGTTGG - Intronic
1002305674 5:178281196-178281218 ATCTAAAAACAGATGAATTTGGG + Intronic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1004229591 6:13819357-13819379 CTGTACAAAGAGATATAGGTTGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006819288 6:36878700-36878722 CTGTAACAATAGCTGAATGTTGG + Intronic
1011098045 6:83688401-83688423 CAGTAAAAAGAAAGGAAGGTTGG - Intronic
1013066008 6:106685043-106685065 CTGTACAAACAAATCAAGGATGG + Intergenic
1013130666 6:107229609-107229631 CCATAAAAATGGATGAAGGTGGG - Intronic
1013934978 6:115583100-115583122 ATAGAAAAACAGATTAAGGTAGG - Intergenic
1016690009 6:146926621-146926643 CTGTAAAAATAGCTGAATGTTGG + Intergenic
1016774112 6:147885423-147885445 CTTTAAAAACAAAATAAGGTTGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017355180 6:153496733-153496755 CTGAAAAAAGGGAGGAAGGTGGG - Intergenic
1017599151 6:156061892-156061914 TTGTAAAATCAGGTGAAGGAAGG + Intergenic
1018151859 6:160947094-160947116 CTTTAATAACACAGGAAGGTTGG - Intergenic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1020838659 7:13186350-13186372 CTTTAAAAAAAGATGAGGCTGGG + Intergenic
1021426322 7:20503539-20503561 CTAGAAAGACAGATGAAAGTTGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023280968 7:38569121-38569143 CAGCAAAAATAGATGAGGGTTGG - Intronic
1023634437 7:42195475-42195497 CTGTAAAAACAGATGTGAGGAGG - Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1025738599 7:64176889-64176911 CAGTAAAAAGAGATGAAAATTGG + Intronic
1025851314 7:65246956-65246978 CTGTAAAAGTAGATGAAGAGGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026416396 7:70185407-70185429 CAGAAAAAACAGTTGAATGTTGG - Intronic
1027682142 7:81233908-81233930 CTCTAAAAGCATATAAAGGTTGG - Intergenic
1027960605 7:84940901-84940923 CTGTAACAACAGCTGAGTGTTGG + Intergenic
1028170923 7:87594813-87594835 CTATAAAAATAGTTGTAGGTAGG - Intronic
1028322166 7:89473704-89473726 ATGGGAAAACTGATGAAGGTTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1033933447 7:146552718-146552740 GAGTCAAAACAGATGAAGGCAGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035411355 7:158645308-158645330 ATATAAAAACAGATGCAGGGTGG + Intronic
1036545266 8:9762600-9762622 CTGTAACAACAGATAAAATTGGG + Intronic
1037269353 8:17109142-17109164 AAATAAAAACAGATTAAGGTAGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039673603 8:39633827-39633849 CTGTAAAAAAAAAAAAAGGTGGG + Intronic
1039806144 8:41001359-41001381 CAGCAATAACAGATGTAGGTGGG + Intergenic
1041870595 8:62630297-62630319 CTATAAAAACATATGTAGGATGG + Intronic
1042566977 8:70121465-70121487 CCCTAAAAACAGAGGAAGGGCGG - Intronic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1043000327 8:74751839-74751861 CTGTATAAACAGATGACTGTAGG + Intronic
1043465531 8:80502825-80502847 CTATGTAAACAAATGAAGGTAGG + Intronic
1043798441 8:84576938-84576960 CTGTAAACTAACATGAAGGTTGG - Intronic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046662905 8:116967955-116967977 CTGCACAAACAGATGAGGGTTGG + Intronic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1048423181 8:134297276-134297298 CTGTAACAACAGAACAGGGTGGG + Intergenic
1048704156 8:137131661-137131683 CTGTAACACTAGAGGAAGGTAGG - Intergenic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1052647676 9:31256816-31256838 CTGTAAAAACAGGTGATAGTCGG - Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1055979253 9:81985764-81985786 CTGTAACAACAGCTGAGTGTTGG - Intergenic
1056405881 9:86274639-86274661 CAGGAAAAACACCTGAAGGTTGG - Intronic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1056950907 9:91039986-91040008 CGGTCAGAACAGATGGAGGTGGG + Intergenic
1057238637 9:93388606-93388628 CTGTAAAGACATATGATGTTGGG + Intergenic
1060125890 9:121044684-121044706 CTGAAAAACTAGATTAAGGTGGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186269093 X:7865615-7865637 CTGAAAGATCAGATGTAGGTTGG + Intergenic
1186769987 X:12808258-12808280 ATGTAAAAACACATGCAGGAAGG - Intronic
1186899646 X:14040086-14040108 CTCTACTAACAGATGAAGATAGG - Intergenic
1187025616 X:15432997-15433019 CTGTCAAGACAGGTGAGGGTGGG + Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187527394 X:20066437-20066459 CTGCAAAACCAGATGTATGTGGG - Intronic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1190480871 X:50875479-50875501 CTGTAAAATCCAATGAATGTGGG - Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1190879843 X:54484276-54484298 CTGCAAGAACACATGAGGGTGGG - Intronic
1194791313 X:98154132-98154154 CTGTCACAAGAGATGAAGATGGG - Intergenic
1195020613 X:100823411-100823433 CTGATGAAACAAATGAAGGTGGG + Exonic
1195952346 X:110288318-110288340 CTGTAAAGATATATGAGGGTGGG - Intronic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196400034 X:115305683-115305705 TTGTAAAAAAAGCAGAAGGTTGG - Intronic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1202012920 Y:20367976-20367998 ATATAAAAACAAATGAAGGGGGG + Intergenic