ID: 1020306681

View in Genome Browser
Species Human (GRCh38)
Location 7:6841111-6841133
Sequence CCTCATATCCAGAGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020306677_1020306681 -9 Left 1020306677 7:6841097-6841119 CCTGTGAAAATCTTCCTCATATC No data
Right 1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG No data
1020306674_1020306681 17 Left 1020306674 7:6841071-6841093 CCAATATCGCAGGGGGTGTACAC No data
Right 1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG No data
1020306676_1020306681 -8 Left 1020306676 7:6841096-6841118 CCCTGTGAAAATCTTCCTCATAT No data
Right 1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG No data
1020306675_1020306681 -7 Left 1020306675 7:6841095-6841117 CCCCTGTGAAAATCTTCCTCATA No data
Right 1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG No data
1020306673_1020306681 18 Left 1020306673 7:6841070-6841092 CCCAATATCGCAGGGGGTGTACA 0: 162
1: 699
2: 1290
3: 1803
4: 1767
Right 1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020306681 Original CRISPR CCTCATATCCAGAGGGAGAG AGG Intergenic
No off target data available for this crispr