ID: 1020307023

View in Genome Browser
Species Human (GRCh38)
Location 7:6843224-6843246
Sequence AAAAGGGCCTATTGAACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020307023_1020307027 6 Left 1020307023 7:6843224-6843246 CCCAGAGTTCAATAGGCCCTTTT No data
Right 1020307027 7:6843253-6843275 AGCATGCTCCATGCACTTAAAGG No data
1020307023_1020307028 7 Left 1020307023 7:6843224-6843246 CCCAGAGTTCAATAGGCCCTTTT No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307023_1020307030 16 Left 1020307023 7:6843224-6843246 CCCAGAGTTCAATAGGCCCTTTT No data
Right 1020307030 7:6843263-6843285 ATGCACTTAAAGGGTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020307023 Original CRISPR AAAAGGGCCTATTGAACTCT GGG (reversed) Intergenic