ID: 1020307026

View in Genome Browser
Species Human (GRCh38)
Location 7:6843241-6843263
Sequence TGGAGCATGCTAGAAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020307026_1020307028 -10 Left 1020307026 7:6843241-6843263 CCTTTTCTTTCTAGCATGCTCCA No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307026_1020307030 -1 Left 1020307026 7:6843241-6843263 CCTTTTCTTTCTAGCATGCTCCA No data
Right 1020307030 7:6843263-6843285 ATGCACTTAAAGGGTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020307026 Original CRISPR TGGAGCATGCTAGAAAGAAA AGG (reversed) Intergenic