ID: 1020307028

View in Genome Browser
Species Human (GRCh38)
Location 7:6843254-6843276
Sequence GCATGCTCCATGCACTTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020307024_1020307028 6 Left 1020307024 7:6843225-6843247 CCAGAGTTCAATAGGCCCTTTTC No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307025_1020307028 -9 Left 1020307025 7:6843240-6843262 CCCTTTTCTTTCTAGCATGCTCC No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307019_1020307028 15 Left 1020307019 7:6843216-6843238 CCTTTTCCCCCAGAGTTCAATAG No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307021_1020307028 9 Left 1020307021 7:6843222-6843244 CCCCCAGAGTTCAATAGGCCCTT No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307023_1020307028 7 Left 1020307023 7:6843224-6843246 CCCAGAGTTCAATAGGCCCTTTT No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307022_1020307028 8 Left 1020307022 7:6843223-6843245 CCCCAGAGTTCAATAGGCCCTTT No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data
1020307026_1020307028 -10 Left 1020307026 7:6843241-6843263 CCTTTTCTTTCTAGCATGCTCCA No data
Right 1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020307028 Original CRISPR GCATGCTCCATGCACTTAAA GGG Intergenic