ID: 1020307600

View in Genome Browser
Species Human (GRCh38)
Location 7:6846968-6846990
Sequence TGCACACCCACTGCTATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020307600_1020307606 10 Left 1020307600 7:6846968-6846990 CCCAAGATAGCAGTGGGTGTGCA No data
Right 1020307606 7:6847001-6847023 GATATTCCTCCTAATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020307600 Original CRISPR TGCACACCCACTGCTATCTT GGG (reversed) Intergenic
No off target data available for this crispr