ID: 1020307601

View in Genome Browser
Species Human (GRCh38)
Location 7:6846969-6846991
Sequence ATGCACACCCACTGCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020307601_1020307606 9 Left 1020307601 7:6846969-6846991 CCAAGATAGCAGTGGGTGTGCAT No data
Right 1020307606 7:6847001-6847023 GATATTCCTCCTAATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020307601 Original CRISPR ATGCACACCCACTGCTATCT TGG (reversed) Intergenic
No off target data available for this crispr