ID: 1020309075

View in Genome Browser
Species Human (GRCh38)
Location 7:6855450-6855472
Sequence GAGGAGCGAGGCTGAGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020309066_1020309075 8 Left 1020309066 7:6855419-6855441 CCGACCTAAGACGTGGTAAACTG No data
Right 1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG No data
1020309065_1020309075 9 Left 1020309065 7:6855418-6855440 CCCGACCTAAGACGTGGTAAACT No data
Right 1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG No data
1020309068_1020309075 4 Left 1020309068 7:6855423-6855445 CCTAAGACGTGGTAAACTGAGGC No data
Right 1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG No data
1020309062_1020309075 12 Left 1020309062 7:6855415-6855437 CCCCCCGACCTAAGACGTGGTAA No data
Right 1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG No data
1020309063_1020309075 11 Left 1020309063 7:6855416-6855438 CCCCCGACCTAAGACGTGGTAAA No data
Right 1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG No data
1020309064_1020309075 10 Left 1020309064 7:6855417-6855439 CCCCGACCTAAGACGTGGTAAAC No data
Right 1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020309075 Original CRISPR GAGGAGCGAGGCTGAGTCCG GGG Intergenic
No off target data available for this crispr