ID: 1020319599

View in Genome Browser
Species Human (GRCh38)
Location 7:6929989-6930011
Sequence CTGCAGTTTAGGAAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020319596_1020319599 -9 Left 1020319596 7:6929975-6929997 CCGGGTGGGCCAGGCTGCAGTTT No data
Right 1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG No data
1020319591_1020319599 9 Left 1020319591 7:6929957-6929979 CCACAAATGATGCTGGAGCCGGG No data
Right 1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020319599 Original CRISPR CTGCAGTTTAGGAAGTGATC AGG Intergenic
No off target data available for this crispr