ID: 1020319599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:6929989-6930011 |
| Sequence | CTGCAGTTTAGGAAGTGATC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020319596_1020319599 | -9 | Left | 1020319596 | 7:6929975-6929997 | CCGGGTGGGCCAGGCTGCAGTTT | No data | ||
| Right | 1020319599 | 7:6929989-6930011 | CTGCAGTTTAGGAAGTGATCAGG | No data | ||||
| 1020319591_1020319599 | 9 | Left | 1020319591 | 7:6929957-6929979 | CCACAAATGATGCTGGAGCCGGG | No data | ||
| Right | 1020319599 | 7:6929989-6930011 | CTGCAGTTTAGGAAGTGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020319599 | Original CRISPR | CTGCAGTTTAGGAAGTGATC AGG | Intergenic | ||
| No off target data available for this crispr | |||||