ID: 1020319783

View in Genome Browser
Species Human (GRCh38)
Location 7:6931121-6931143
Sequence TTATCCTGCGTTTGGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020319777_1020319783 25 Left 1020319777 7:6931073-6931095 CCATGCCCCTGCTAGCGTATTAC No data
Right 1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG No data
1020319775_1020319783 27 Left 1020319775 7:6931071-6931093 CCCCATGCCCCTGCTAGCGTATT No data
Right 1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG No data
1020319778_1020319783 20 Left 1020319778 7:6931078-6931100 CCCCTGCTAGCGTATTACTGTTC No data
Right 1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG No data
1020319780_1020319783 18 Left 1020319780 7:6931080-6931102 CCTGCTAGCGTATTACTGTTCTG No data
Right 1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG No data
1020319776_1020319783 26 Left 1020319776 7:6931072-6931094 CCCATGCCCCTGCTAGCGTATTA No data
Right 1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG No data
1020319779_1020319783 19 Left 1020319779 7:6931079-6931101 CCCTGCTAGCGTATTACTGTTCT No data
Right 1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020319783 Original CRISPR TTATCCTGCGTTTGGTCTCC AGG Intergenic
No off target data available for this crispr