ID: 1020321469

View in Genome Browser
Species Human (GRCh38)
Location 7:6941597-6941619
Sequence TGAGAACCTGCATTTCGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020321463_1020321469 13 Left 1020321463 7:6941561-6941583 CCAATGCAGACTTGCTGGCCCAC No data
Right 1020321469 7:6941597-6941619 TGAGAACCTGCATTTCGACAAGG No data
1020321464_1020321469 -5 Left 1020321464 7:6941579-6941601 CCCACTGAGCCTCCCAGCTGAGA No data
Right 1020321469 7:6941597-6941619 TGAGAACCTGCATTTCGACAAGG No data
1020321465_1020321469 -6 Left 1020321465 7:6941580-6941602 CCACTGAGCCTCCCAGCTGAGAA No data
Right 1020321469 7:6941597-6941619 TGAGAACCTGCATTTCGACAAGG No data
1020321461_1020321469 19 Left 1020321461 7:6941555-6941577 CCTAAACCAATGCAGACTTGCTG No data
Right 1020321469 7:6941597-6941619 TGAGAACCTGCATTTCGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020321469 Original CRISPR TGAGAACCTGCATTTCGACA AGG Intergenic
No off target data available for this crispr