ID: 1020323065

View in Genome Browser
Species Human (GRCh38)
Location 7:6954404-6954426
Sequence AAGGGCCTATTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020323065_1020323074 18 Left 1020323065 7:6954404-6954426 CCCCCAGAGTTCAATAGGCCCTT No data
Right 1020323074 7:6954445-6954467 ATGCACTAGAAGGGTTAAAAAGG No data
1020323065_1020323072 9 Left 1020323065 7:6954404-6954426 CCCCCAGAGTTCAATAGGCCCTT No data
Right 1020323072 7:6954436-6954458 TAATGCTCCATGCACTAGAAGGG No data
1020323065_1020323071 8 Left 1020323065 7:6954404-6954426 CCCCCAGAGTTCAATAGGCCCTT No data
Right 1020323071 7:6954435-6954457 ATAATGCTCCATGCACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020323065 Original CRISPR AAGGGCCTATTGAACTCTGG GGG (reversed) Intergenic