ID: 1020324633

View in Genome Browser
Species Human (GRCh38)
Location 7:6964887-6964909
Sequence ACCAAAATTGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020324633_1020324643 24 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324643 7:6964934-6964956 TACTGGCAGCTAATGGGTAGAGG No data
1020324633_1020324638 -5 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324638 7:6964905-6964927 TTGGTGGTTGCGGCTGGAGGAGG No data
1020324633_1020324637 -8 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324637 7:6964902-6964924 ATTTTGGTGGTTGCGGCTGGAGG No data
1020324633_1020324645 30 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324645 7:6964940-6964962 CAGCTAATGGGTAGAGGCCAGGG No data
1020324633_1020324641 17 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324641 7:6964927-6964949 GTGGTGCTACTGGCAGCTAATGG No data
1020324633_1020324644 29 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324644 7:6964939-6964961 GCAGCTAATGGGTAGAGGCCAGG No data
1020324633_1020324639 -2 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324639 7:6964908-6964930 GTGGTTGCGGCTGGAGGAGGTGG No data
1020324633_1020324642 18 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324642 7:6964928-6964950 TGGTGCTACTGGCAGCTAATGGG No data
1020324633_1020324640 7 Left 1020324633 7:6964887-6964909 CCATGTCTGGAGACAATTTTGGT No data
Right 1020324640 7:6964917-6964939 GCTGGAGGAGGTGGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020324633 Original CRISPR ACCAAAATTGTCTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr