ID: 1020324769

View in Genome Browser
Species Human (GRCh38)
Location 7:6965962-6965984
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020324769_1020324778 12 Left 1020324769 7:6965962-6965984 CCAGTGAGGGGTTCATGTACTGT No data
Right 1020324778 7:6965997-6966019 AGATGGAGTTGGGATTGCCCTGG No data
1020324769_1020324774 2 Left 1020324769 7:6965962-6965984 CCAGTGAGGGGTTCATGTACTGT No data
Right 1020324774 7:6965987-6966009 GCAGCCCCGCAGATGGAGTTGGG No data
1020324769_1020324772 -5 Left 1020324769 7:6965962-6965984 CCAGTGAGGGGTTCATGTACTGT No data
Right 1020324772 7:6965980-6966002 ACTGTGGGCAGCCCCGCAGATGG No data
1020324769_1020324773 1 Left 1020324769 7:6965962-6965984 CCAGTGAGGGGTTCATGTACTGT No data
Right 1020324773 7:6965986-6966008 GGCAGCCCCGCAGATGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020324769 Original CRISPR ACAGTACATGAACCCCTCAC TGG (reversed) Intergenic