ID: 1020324774

View in Genome Browser
Species Human (GRCh38)
Location 7:6965987-6966009
Sequence GCAGCCCCGCAGATGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020324769_1020324774 2 Left 1020324769 7:6965962-6965984 CCAGTGAGGGGTTCATGTACTGT No data
Right 1020324774 7:6965987-6966009 GCAGCCCCGCAGATGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020324774 Original CRISPR GCAGCCCCGCAGATGGAGTT GGG Intergenic