ID: 1020333125

View in Genome Browser
Species Human (GRCh38)
Location 7:7040424-7040446
Sequence ATATCCAATGGACAGTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020333125_1020333129 4 Left 1020333125 7:7040424-7040446 CCATAGCACTGTCCATTGGATAT No data
Right 1020333129 7:7040451-7040473 ACCGAATCTGCAGGGAACTTTGG No data
1020333125_1020333127 -5 Left 1020333125 7:7040424-7040446 CCATAGCACTGTCCATTGGATAT No data
Right 1020333127 7:7040442-7040464 GATATCTGAACCGAATCTGCAGG No data
1020333125_1020333128 -4 Left 1020333125 7:7040424-7040446 CCATAGCACTGTCCATTGGATAT No data
Right 1020333128 7:7040443-7040465 ATATCTGAACCGAATCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020333125 Original CRISPR ATATCCAATGGACAGTGCTA TGG (reversed) Intergenic
No off target data available for this crispr