ID: 1020333393

View in Genome Browser
Species Human (GRCh38)
Location 7:7042324-7042346
Sequence AGCCGAGTGGTCTTGCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020333380_1020333393 28 Left 1020333380 7:7042273-7042295 CCTAGTGAGATAGAACTGTTCAC No data
Right 1020333393 7:7042324-7042346 AGCCGAGTGGTCTTGCCCAGTGG No data
1020333386_1020333393 4 Left 1020333386 7:7042297-7042319 CCCCTGGAAAGGGGGCTGAAGCC 0: 473
1: 560
2: 333
3: 223
4: 354
Right 1020333393 7:7042324-7042346 AGCCGAGTGGTCTTGCCCAGTGG No data
1020333387_1020333393 3 Left 1020333387 7:7042298-7042320 CCCTGGAAAGGGGGCTGAAGCCA 0: 544
1: 578
2: 353
3: 262
4: 455
Right 1020333393 7:7042324-7042346 AGCCGAGTGGTCTTGCCCAGTGG No data
1020333379_1020333393 29 Left 1020333379 7:7042272-7042294 CCCTAGTGAGATAGAACTGTTCA No data
Right 1020333393 7:7042324-7042346 AGCCGAGTGGTCTTGCCCAGTGG No data
1020333388_1020333393 2 Left 1020333388 7:7042299-7042321 CCTGGAAAGGGGGCTGAAGCCAG 0: 545
1: 595
2: 365
3: 259
4: 625
Right 1020333393 7:7042324-7042346 AGCCGAGTGGTCTTGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020333393 Original CRISPR AGCCGAGTGGTCTTGCCCAG TGG Intergenic
No off target data available for this crispr