ID: 1020334371

View in Genome Browser
Species Human (GRCh38)
Location 7:7051342-7051364
Sequence AAGTGTGGCAAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020334365_1020334371 13 Left 1020334365 7:7051306-7051328 CCATTTCTAGGAAGAAACATTTG No data
Right 1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020334371 Original CRISPR AAGTGTGGCAAGAGGGAGGA GGG Intergenic
No off target data available for this crispr