ID: 1020335193

View in Genome Browser
Species Human (GRCh38)
Location 7:7057513-7057535
Sequence GAGTACACACCCTGCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020335193_1020335197 12 Left 1020335193 7:7057513-7057535 CCCATATGGCAGGGTGTGTACTC No data
Right 1020335197 7:7057548-7057570 TTGTCCATAACATCTAGAGCGGG No data
1020335193_1020335199 17 Left 1020335193 7:7057513-7057535 CCCATATGGCAGGGTGTGTACTC No data
Right 1020335199 7:7057553-7057575 CATAACATCTAGAGCGGGAGAGG No data
1020335193_1020335196 11 Left 1020335193 7:7057513-7057535 CCCATATGGCAGGGTGTGTACTC No data
Right 1020335196 7:7057547-7057569 ATTGTCCATAACATCTAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020335193 Original CRISPR GAGTACACACCCTGCCATAT GGG (reversed) Intergenic
No off target data available for this crispr