ID: 1020335581

View in Genome Browser
Species Human (GRCh38)
Location 7:7059878-7059900
Sequence TTCATATATCCAAGGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020335581_1020335588 -6 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335588 7:7059895-7059917 TATGAAACAATATGACAGGCGGG No data
1020335581_1020335586 -10 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335586 7:7059891-7059913 GATATATGAAACAATATGACAGG No data
1020335581_1020335592 18 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335592 7:7059919-7059941 TGGACACACCTCGCCATATAGGG No data
1020335581_1020335591 17 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG No data
1020335581_1020335589 -5 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335589 7:7059896-7059918 ATGAAACAATATGACAGGCGGGG No data
1020335581_1020335590 -2 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335590 7:7059899-7059921 AAACAATATGACAGGCGGGGTGG No data
1020335581_1020335587 -7 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335587 7:7059894-7059916 ATATGAAACAATATGACAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020335581 Original CRISPR TTCATATATCCAAGGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr