ID: 1020335582

View in Genome Browser
Species Human (GRCh38)
Location 7:7059883-7059905
Sequence ATTGTTTCATATATCCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020335582_1020335591 12 Left 1020335582 7:7059883-7059905 CCCCCTTGGATATATGAAACAAT No data
Right 1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG No data
1020335582_1020335592 13 Left 1020335582 7:7059883-7059905 CCCCCTTGGATATATGAAACAAT No data
Right 1020335592 7:7059919-7059941 TGGACACACCTCGCCATATAGGG No data
1020335582_1020335589 -10 Left 1020335582 7:7059883-7059905 CCCCCTTGGATATATGAAACAAT No data
Right 1020335589 7:7059896-7059918 ATGAAACAATATGACAGGCGGGG No data
1020335582_1020335590 -7 Left 1020335582 7:7059883-7059905 CCCCCTTGGATATATGAAACAAT No data
Right 1020335590 7:7059899-7059921 AAACAATATGACAGGCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020335582 Original CRISPR ATTGTTTCATATATCCAAGG GGG (reversed) Intergenic
No off target data available for this crispr