ID: 1020335591

View in Genome Browser
Species Human (GRCh38)
Location 7:7059918-7059940
Sequence GTGGACACACCTCGCCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020335584_1020335591 10 Left 1020335584 7:7059885-7059907 CCCTTGGATATATGAAACAATAT No data
Right 1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG No data
1020335581_1020335591 17 Left 1020335581 7:7059878-7059900 CCTCTCCCCCTTGGATATATGAA No data
Right 1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG No data
1020335582_1020335591 12 Left 1020335582 7:7059883-7059905 CCCCCTTGGATATATGAAACAAT No data
Right 1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG No data
1020335583_1020335591 11 Left 1020335583 7:7059884-7059906 CCCCTTGGATATATGAAACAATA No data
Right 1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG No data
1020335585_1020335591 9 Left 1020335585 7:7059886-7059908 CCTTGGATATATGAAACAATATG No data
Right 1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020335591 Original CRISPR GTGGACACACCTCGCCATAT AGG Intergenic
No off target data available for this crispr