ID: 1020336033

View in Genome Browser
Species Human (GRCh38)
Location 7:7063053-7063075
Sequence GTGTACACCCACTGCGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020336033_1020336038 12 Left 1020336033 7:7063053-7063075 CCAATATCGCAGTGGGTGTACAC No data
Right 1020336038 7:7063088-7063110 ATTGTTCTTAAAATCCAGGGAGG No data
1020336033_1020336040 18 Left 1020336033 7:7063053-7063075 CCAATATCGCAGTGGGTGTACAC No data
Right 1020336040 7:7063094-7063116 CTTAAAATCCAGGGAGGGAGAGG No data
1020336033_1020336036 8 Left 1020336033 7:7063053-7063075 CCAATATCGCAGTGGGTGTACAC No data
Right 1020336036 7:7063084-7063106 TGGTATTGTTCTTAAAATCCAGG No data
1020336033_1020336037 9 Left 1020336033 7:7063053-7063075 CCAATATCGCAGTGGGTGTACAC No data
Right 1020336037 7:7063085-7063107 GGTATTGTTCTTAAAATCCAGGG No data
1020336033_1020336039 13 Left 1020336033 7:7063053-7063075 CCAATATCGCAGTGGGTGTACAC No data
Right 1020336039 7:7063089-7063111 TTGTTCTTAAAATCCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020336033 Original CRISPR GTGTACACCCACTGCGATAT TGG (reversed) Intergenic
No off target data available for this crispr