ID: 1020339071

View in Genome Browser
Species Human (GRCh38)
Location 7:7089572-7089594
Sequence GAGGGTAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020339071_1020339082 23 Left 1020339071 7:7089572-7089594 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1020339082 7:7089618-7089640 CCAGTCTCAGTGAGATGAGCTGG No data
1020339071_1020339083 24 Left 1020339071 7:7089572-7089594 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1020339083 7:7089619-7089641 CAGTCTCAGTGAGATGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020339071 Original CRISPR GAGGGTAAGCAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr