ID: 1020340558

View in Genome Browser
Species Human (GRCh38)
Location 7:7105096-7105118
Sequence CCGTCACCTATCTGCGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020340550_1020340558 26 Left 1020340550 7:7105047-7105069 CCTCCTTTGGAAAGACTCAAAAG No data
Right 1020340558 7:7105096-7105118 CCGTCACCTATCTGCGACCTGGG No data
1020340551_1020340558 23 Left 1020340551 7:7105050-7105072 CCTTTGGAAAGACTCAAAAGAAA No data
Right 1020340558 7:7105096-7105118 CCGTCACCTATCTGCGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020340558 Original CRISPR CCGTCACCTATCTGCGACCT GGG Intergenic
No off target data available for this crispr