ID: 1020342661

View in Genome Browser
Species Human (GRCh38)
Location 7:7129397-7129419
Sequence CAGATTTCTTATCCGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020342661_1020342666 29 Left 1020342661 7:7129397-7129419 CCATTTTACGGATAAGAAATCTG No data
Right 1020342666 7:7129449-7129471 AAAGTTTGTAGGTAGAAAGCTGG No data
1020342661_1020342665 18 Left 1020342661 7:7129397-7129419 CCATTTTACGGATAAGAAATCTG No data
Right 1020342665 7:7129438-7129460 TGTACAAGGTCAAAGTTTGTAGG No data
1020342661_1020342664 4 Left 1020342661 7:7129397-7129419 CCATTTTACGGATAAGAAATCTG No data
Right 1020342664 7:7129424-7129446 CAGCACATGCAACTTGTACAAGG No data
1020342661_1020342667 30 Left 1020342661 7:7129397-7129419 CCATTTTACGGATAAGAAATCTG No data
Right 1020342667 7:7129450-7129472 AAGTTTGTAGGTAGAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020342661 Original CRISPR CAGATTTCTTATCCGTAAAA TGG (reversed) Intergenic
No off target data available for this crispr