ID: 1020342664

View in Genome Browser
Species Human (GRCh38)
Location 7:7129424-7129446
Sequence CAGCACATGCAACTTGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020342661_1020342664 4 Left 1020342661 7:7129397-7129419 CCATTTTACGGATAAGAAATCTG No data
Right 1020342664 7:7129424-7129446 CAGCACATGCAACTTGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020342664 Original CRISPR CAGCACATGCAACTTGTACA AGG Intergenic
No off target data available for this crispr