ID: 1020350549

View in Genome Browser
Species Human (GRCh38)
Location 7:7214286-7214308
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 3, 1: 14, 2: 23, 3: 32, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020350549_1020350556 25 Left 1020350549 7:7214286-7214308 CCTGTTTTTCCCAAGGAGTTCCA 0: 3
1: 14
2: 23
3: 32
4: 184
Right 1020350556 7:7214334-7214356 TCTCATGCATGCATTAAGAGTGG No data
1020350549_1020350553 -1 Left 1020350549 7:7214286-7214308 CCTGTTTTTCCCAAGGAGTTCCA 0: 3
1: 14
2: 23
3: 32
4: 184
Right 1020350553 7:7214308-7214330 ATGCTACCAGAAGTTATCTTAGG 0: 16
1: 27
2: 42
3: 63
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020350549 Original CRISPR TGGAACTCCTTGGGAAAAAC AGG (reversed) Intronic
900735496 1:4297197-4297219 AGGAACTGCTTGGGAAGAATGGG + Intergenic
901877159 1:12173471-12173493 TGGAGCTCCTTAGGCAGAACTGG + Intronic
902925742 1:19694650-19694672 TGGAGCTTCTGGGGGAAAACAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
910899339 1:92102817-92102839 TCCAATTACTTGGGAAAAACTGG - Intronic
911057323 1:93720173-93720195 TGGAACTTCAGGGGAGAAACAGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
917765849 1:178216103-178216125 TAGAAGTCCTTAGGAAAGACTGG + Intronic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1069623554 10:69852783-69852805 TGGACCTCGCTGGGCAAAACTGG + Intronic
1070553148 10:77507206-77507228 TGGAACACCATGGGAAAATGAGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071988172 10:91073560-91073582 TGGAACTCATGAGGACAAACTGG + Intergenic
1072457718 10:95591338-95591360 TGGACCTCCTTGGGACACCCTGG - Intergenic
1072675220 10:97460616-97460638 TGGAAGTCCTTGGGAGGAATAGG + Intronic
1076538122 10:131195916-131195938 TGGAGCTCCTTGGAGAACACAGG + Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080903443 11:36517093-36517115 TTGAACTTGGTGGGAAAAACAGG + Intronic
1081778004 11:45689645-45689667 GGGAACACCTGGGGTAAAACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1084958251 11:72702912-72702934 TGGAATTCCTTCGGAACAACCGG - Exonic
1085272091 11:75276413-75276435 TCCAACTCATTGGGAAAAAGGGG - Intronic
1085709899 11:78819839-78819861 AGGAACTCTTTGGGAACACCTGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087383794 11:97443734-97443756 TGGAACTCATTGGGATGAATTGG - Intergenic
1087462843 11:98466974-98466996 TGGAATTTATTGGGAAAAAAGGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087837625 11:102890698-102890720 TGGAACTCCTTAGCAGAATCTGG - Intergenic
1087863913 11:103199413-103199435 TGGAAATCTTTGGAGAAAACAGG - Exonic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1090281955 11:125463945-125463967 TGGAACTCCTTAACAAAATCAGG - Intronic
1091594722 12:1869544-1869566 TGGAACTCAAGAGGAAAAACAGG - Intronic
1092670460 12:10855508-10855530 AGGAACTTATTGGGAACAACTGG + Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095705344 12:45230885-45230907 TTGAACTCCTGGGGAACTACAGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097806124 12:63966941-63966963 TGGAAATTCTTAGGAAAAAAAGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101289492 12:103353260-103353282 TGGAACTCCATGAGAACAAAAGG - Intronic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1102407926 12:112690343-112690365 TGGAAAACCTTGGGACAAAAGGG - Intronic
1102636045 12:114324997-114325019 TGGTTCTCCTAAGGAAAAACTGG + Intergenic
1103180408 12:118906401-118906423 TGTTACACCTTGGGAAACACTGG - Intergenic
1103192807 12:119016797-119016819 TGGAAGTGCTTGGGAATGACAGG + Intronic
1105885731 13:24639545-24639567 TGGAATTCATTGGGTAAAAAGGG + Intergenic
1106189380 13:27437912-27437934 TGGAACTCATTAAGAAAAAAAGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1109469678 13:62789123-62789145 TGTAACTTCTGGGGGAAAACAGG - Intergenic
1110533347 13:76622598-76622620 TGGAACTTCTTTTGTAAAACAGG - Intergenic
1112603039 13:100875769-100875791 TTGAACTTCTTGGGCAAACCAGG - Intergenic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1115631284 14:35248243-35248265 TGAATCTCTTTGGGAAAAAATGG - Intronic
1115789034 14:36858127-36858149 GGGACCTCCTAGGGAAAAAGAGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118739865 14:68731485-68731507 GGGAACTAATTGGGAAAGACAGG + Intergenic
1119094058 14:71812622-71812644 TGGAGCTGCGTGGGAACAACAGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1124599462 15:31120285-31120307 TGGAACTTATTGGGATAAATAGG + Intronic
1125339869 15:38664272-38664294 TGGAACTCCTTTTGCAAAATAGG - Intergenic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1131755154 15:95551514-95551536 TGAAACTCTTTGGGAAGAAAAGG + Intergenic
1131804545 15:96107698-96107720 TGGAGAACTTTGGGAAAAACTGG - Intergenic
1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG + Intronic
1133767206 16:8846446-8846468 AGGAATTCCATGAGAAAAACGGG + Intronic
1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG + Exonic
1134307474 16:13046124-13046146 TGCCTCTCCTTGGGAAAAGCAGG + Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1141393222 16:83681679-83681701 GGGAGCTCTTTGGGAAAAAGAGG + Intronic
1143083074 17:4395903-4395925 TGGAACTGCTACGGAAGAACGGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1149030424 17:52076733-52076755 TGGATCTCCTAGAGAAATACAGG + Intronic
1149102325 17:52921867-52921889 TGGAATTTATTGGGAAAAAAAGG + Intergenic
1151692789 17:75697146-75697168 AGGAAAGCCTTTGGAAAAACAGG - Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG + Intergenic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1162758382 19:12874031-12874053 TGGAAGTCCTTGCGGAAATCCGG - Exonic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166426421 19:42682885-42682907 TGGGACCACTTAGGAAAAACAGG - Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
930097381 2:47575751-47575773 TGGAAGGCCCTGGGTAAAACTGG - Intergenic
931978517 2:67669378-67669400 TGGAACTGCTTTGAAATAACAGG - Intergenic
932084221 2:68743824-68743846 TGGAACTCAGTGTGAAAACCAGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935556180 2:104511968-104511990 TCGACCTCCTTAGGAGAAACTGG + Intergenic
939671886 2:145022847-145022869 TGGAACTCATTGCAAGAAACTGG + Intergenic
939766204 2:146252600-146252622 TGGAAATGCTTGGGAGAAAGAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG + Intronic
945988520 2:216373338-216373360 AGAAACTCCTTGAGAAAAATAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1168755805 20:316805-316827 AGGAATTCATTGGGGAAAACAGG + Intergenic
1171377616 20:24704112-24704134 TGGACATCCTTAGGAAAAGCCGG - Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1172531963 20:35637586-35637608 AGAAAATCCTTGGGGAAAACAGG - Intronic
1173111374 20:40193498-40193520 TGGACCACATTTGGAAAAACAGG - Intergenic
1178363373 21:31968404-31968426 AGGAACTCCTCGGGAGAGACGGG + Intronic
1182959629 22:34460078-34460100 TGGAATTCCTGGGGGAAAAGAGG - Intergenic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG + Intergenic
950919114 3:16676339-16676361 TAAAACCCCTTTGGAAAAACTGG + Intergenic
951316897 3:21198214-21198236 TAAAACTACTAGGGAAAAACAGG - Intergenic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
953022287 3:39122490-39122512 TGGAACTCTTTGGGGAAAGCTGG - Intronic
954331953 3:49895924-49895946 TGGACCTCCCTGGGAAACACGGG - Intronic
954714075 3:52518461-52518483 TGGATCTCCTGGGGAAGACCTGG - Intronic
955061992 3:55500750-55500772 TGGAACTCCTGTGGTAAACCAGG - Intergenic
955486575 3:59440063-59440085 TTGAGCCCCTTGGGAAGAACAGG + Intergenic
956334299 3:68146113-68146135 TGGAAGAGCTTGAGAAAAACTGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
957874224 3:86124562-86124584 TGGAACTCCTAGGCAAAGACTGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963644067 3:147891995-147892017 TAGAACTTCTTGGAATAAACAGG + Intergenic
964596127 3:158431106-158431128 TGGAACAGTTTGGGAAATACTGG + Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965449193 3:168816591-168816613 TAGAGCTCCTTGGGGAAACCAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967190371 3:186979458-186979480 AGGAACTCCTTGGGCAGACCTGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969641630 4:8402214-8402236 TGGAGCTCCTTAGGGAAACCTGG + Intronic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972614482 4:40685125-40685147 TGGCCTTCCTTGGGAAAAAGTGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973623739 4:52751345-52751367 TGCAACTCCGAGGGATAAACTGG + Exonic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983813329 4:172091512-172091534 AAAATCTCCTTGGGAAAAACTGG - Intronic
985762646 5:1758543-1758565 TGGAAATCCTAGAGAAACACTGG - Intergenic
986261942 5:6155287-6155309 TGGATCTCCTGGTGAAGAACAGG - Intergenic
988153424 5:27417014-27417036 TGGACTTCCTTAGGAAAAGCAGG - Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
992725485 5:79603000-79603022 TGGAACTCCTTTTGTAAAATTGG + Intergenic
994867988 5:105302954-105302976 TGGAAATCCTTATGAAATACAGG - Intergenic
997457744 5:134029955-134029977 TGTAACCCCTTGGGAAAACTGGG + Intergenic
1001324347 5:170710703-170710725 TGGAATCCCTTGAGAACAACTGG - Intronic
1001641800 5:173249629-173249651 TGGAACTCCTTGGGCTCAAGCGG + Intergenic
1002158301 5:177300096-177300118 TGAAACTCCTAGTGAAAAAGAGG + Exonic
1003548924 6:7084819-7084841 AGGAGCACCTTGGGATAAACTGG - Intergenic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1007167925 6:39841392-39841414 GGGAACTCCTTGGGGAAAGGTGG + Intronic
1008790192 6:55221844-55221866 TGAAACTCATAGAGAAAAACAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011814950 6:91178539-91178561 TGGATCTACTTGGGAACAGCTGG - Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG + Intergenic
1015311678 6:131773724-131773746 TTGAACTCCTTGGTTGAAACTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016392706 6:143591378-143591400 TGGAACACCTAGAAAAAAACAGG - Intronic
1016429945 6:143973063-143973085 TGGACCTTCTTGTGAAAACCAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016911486 6:149203319-149203341 TGGAACCCCAGGAGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1018965240 6:168480191-168480213 TGTAACTTCTTGTTAAAAACTGG - Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021944355 7:25711566-25711588 TGGAAATTTTTGGGAAAAATGGG - Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023661253 7:42473199-42473221 TGGAAAGTCTTGGGAAAACCAGG + Intergenic
1024812821 7:53234072-53234094 TGTCACTCCTTGGTCAAAACTGG - Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027912845 7:84274815-84274837 TGGAACTCCCTAGGCAAACCTGG + Intronic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1029321430 7:99764208-99764230 TCGAAGACCTTGGGGAAAACTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030274358 7:107703879-107703901 TGTTACTCATTGGGAGAAACTGG - Intronic
1031076284 7:117216004-117216026 TAGAAGTCATTGGGAAAATCAGG + Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031360351 7:120842391-120842413 TGGAACCTCTTGGGGAACACAGG + Intronic
1031899070 7:127391016-127391038 TTGAACTCATTGGGAGAATCAGG - Intronic
1033518996 7:142140880-142140902 TGTAACTCCTTGACAAAATCTGG - Exonic
1035243491 7:157547430-157547452 TGGAACTCCTTGGTACAGAGAGG + Intronic
1036440647 8:8778830-8778852 TGGCCCTACTTTGGAAAAACTGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1041445150 8:57943180-57943202 GGGCAATCCTTGGGAGAAACTGG + Intergenic
1041450963 8:58006503-58006525 TAGACCTCCTAGGGTAAAACTGG + Intronic
1041544769 8:59030567-59030589 TGGAACACTTTGTGAACAACTGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044212810 8:89570387-89570409 TGGAAATTCATGGGAAAAATAGG - Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050362471 9:4843682-4843704 TGGAAATTCTTGGGAAATGCAGG + Intronic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050838080 9:10109775-10109797 TGAAACTCATGGGGAAAAATAGG + Intronic
1051374801 9:16392115-16392137 AGCACCTGCTTGGGAAAAACTGG + Intergenic
1051714262 9:19964967-19964989 TTGAACTCCATGGGGAAGACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056052285 9:82781869-82781891 TCGATCTCCTTTGGAAAAAAAGG + Intergenic
1056489069 9:87087159-87087181 TGGACCTCATTTGGAAAAAGGGG + Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1056990547 9:91406352-91406374 TGTAACTCCTTAGGAATAAAAGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057817169 9:98304246-98304268 GGGAACTCCAAGGGAAGAACTGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058981363 9:110173655-110173677 TGGAAATCCTGGGGAGAAAAAGG - Intergenic
1059705002 9:116814442-116814464 TGGAATTCCATGGGAAACTCTGG + Intronic
1187287181 X:17916867-17916889 TGGAGATCCTGGGGAAAATCAGG - Intergenic
1188518149 X:31009648-31009670 TGGAACTTATTGGGCAAAAAGGG - Intergenic
1190540807 X:51476098-51476120 TAAAGCCCCTTGGGAAAAACTGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1196474823 X:116069980-116070002 TGTAACTTCTTAGGAAAAAGGGG - Intergenic
1197130601 X:123001546-123001568 GGGAATTCTTTGGGAAAACCAGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1201749324 Y:17415247-17415269 TGGAACTCCTTGGAGAAACAGGG + Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic