ID: 1020352211

View in Genome Browser
Species Human (GRCh38)
Location 7:7233377-7233399
Sequence GGGAAGAATTGGTAAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020352211_1020352216 18 Left 1020352211 7:7233377-7233399 CCTTATTCTTACCAATTCTTCCC 0: 1
1: 0
2: 4
3: 29
4: 340
Right 1020352216 7:7233418-7233440 TCCCAAGTAGCTGTGACTGCAGG 0: 19
1: 2010
2: 50599
3: 168730
4: 228911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020352211 Original CRISPR GGGAAGAATTGGTAAGAATA AGG (reversed) Intronic
902177200 1:14659422-14659444 GGGAAGTATTGGGAAGATAAGGG + Intronic
903920745 1:26798798-26798820 GGGAAAAAAGGGTAAGAAGAAGG + Intergenic
904288900 1:29471210-29471232 GGCAAGAATTGGATAGAAGAGGG + Intergenic
904367394 1:30023131-30023153 GGGAAGGAGTGGGAAAAATATGG + Intergenic
907778416 1:57541789-57541811 GGCAAGAATTAGTAAGACTATGG - Intronic
908211554 1:61905734-61905756 GGAAAAGGTTGGTAAGAATATGG - Intronic
909168341 1:72258041-72258063 GGGAAGGATTGATAATATTAGGG - Intronic
909744364 1:79075088-79075110 TGTAGGTATTGGTAAGAATATGG + Intergenic
910059390 1:83070246-83070268 GGGAAGATTTATTAAAAATAGGG + Intergenic
910871349 1:91835883-91835905 GGGAAGATTTGGTATTCATAGGG - Intronic
911100734 1:94094060-94094082 GGGAGAAATTGGAAAGAATGAGG + Intronic
911546167 1:99219688-99219710 AGCAAGATTTGGTAAGAATATGG - Intergenic
911997296 1:104782535-104782557 GAGAAGAATAGATAAAAATAGGG - Intergenic
912866921 1:113266107-113266129 GGGAACACGTGGTGAGAATATGG + Intergenic
915651628 1:157316039-157316061 GGGAAGAATTTTAAAGAAGAAGG + Intergenic
916263526 1:162867433-162867455 AGCAAGTATTGGTGAGAATATGG + Intronic
916606314 1:166346023-166346045 GGGAAGAAGTGGCAAGACAATGG - Intergenic
916724348 1:167509555-167509577 GGGAAGAACTGGTGAGAATTTGG + Intronic
917702591 1:177596331-177596353 GGGTAGTAATGGCAAGAATATGG + Intergenic
918354734 1:183696850-183696872 GGCAAGAATTGGTCAGATTCTGG - Intronic
918375528 1:183905449-183905471 GGGAAGAATTGGGGAAAATAAGG + Intronic
919829834 1:201532516-201532538 GGGAAGATTTGATAAGATGATGG - Intergenic
921109571 1:212021114-212021136 ATGCAGAATTGATAAGAATAGGG + Exonic
921559767 1:216643380-216643402 TGGAAGAAATGGTAGGAGTATGG - Intronic
924705799 1:246500975-246500997 TGGAAGAATTGATAATAATGTGG - Intronic
924868420 1:248012072-248012094 TGGAAGAAGTGATTAGAATAAGG - Intronic
1063080509 10:2763091-2763113 GGGAATTATTGGTAACAACAAGG + Intergenic
1064874414 10:19976847-19976869 GGGAAGAAACGGAAAAAATAAGG - Intronic
1065236150 10:23654621-23654643 GGGAAGATGTGGAGAGAATACGG + Intergenic
1065298098 10:24295758-24295780 AGGAAGGATTGGTAGCAATAGGG - Intronic
1066474647 10:35733773-35733795 GCCAAGTGTTGGTAAGAATATGG - Intergenic
1067519033 10:46981096-46981118 TGGAAAAATTGGTGACAATAAGG + Intronic
1067643213 10:48070738-48070760 TGGAAAAATTGGTGACAATAAGG - Intergenic
1068276285 10:54802327-54802349 GGGAAAAATCTTTAAGAATATGG + Intronic
1068393504 10:56429921-56429943 ATGAAGAATTGTTAAGAATGTGG - Intergenic
1068677140 10:59779809-59779831 GGAAAAAATTGGTAAGAAGGTGG - Intergenic
1069575705 10:69526821-69526843 AGCAAGCATTGGTGAGAATATGG + Intergenic
1070482298 10:76894819-76894841 AACAAGAATTGGTAAGAATAAGG + Intronic
1070911427 10:80122239-80122261 GGGAAGTTTTGGTCAGATTAGGG - Intergenic
1071363296 10:84873196-84873218 GCGAATAACTGGTAAGAATGTGG + Intergenic
1072898444 10:99387441-99387463 GGGGTGACTTGGTGAGAATAAGG - Intronic
1074215433 10:111379481-111379503 GGGAAGCATTGACAAGAATTAGG - Intergenic
1078000018 11:7486054-7486076 GAGAAGCATGGGTAAAAATAAGG - Intronic
1078206272 11:9232569-9232591 GCCAAGAGTTGGTAAGGATAGGG + Intronic
1078232423 11:9455460-9455482 TGGAAGTATTGGTAAGAATATGG + Intergenic
1079978070 11:27117298-27117320 AAGAAGAATGGGTAACAATAAGG - Intronic
1080038636 11:27735731-27735753 GGGAATGAATGGGAAGAATATGG + Intergenic
1080119317 11:28658345-28658367 GGGAAGAAGGGGGAACAATAAGG - Intergenic
1080141397 11:28925275-28925297 GGCAAGAATAGGTAAGAACGTGG + Intergenic
1082141181 11:48611296-48611318 GGGAGGAATAGGTAATAAAATGG + Intergenic
1082976876 11:59081329-59081351 GGGAAGAAATGGGTAGAAAATGG - Intergenic
1083400012 11:62417022-62417044 GAGAAGACTTGGGAAAAATAGGG - Intronic
1085087207 11:73677455-73677477 GGGGAGGCTAGGTAAGAATAGGG + Exonic
1087321697 11:96668800-96668822 ACCAAGTATTGGTAAGAATAGGG - Intergenic
1089401940 11:118169364-118169386 GGTTAGAAGTGGTGAGAATAAGG - Intronic
1089407350 11:118209286-118209308 GGTAAGATTTGGTCTGAATAAGG - Intronic
1089922064 11:122218470-122218492 GGGATCAATTGGAAAGAATTTGG + Intergenic
1090155569 11:124434623-124434645 GGTAAAAAGTGGTAAGAAAAGGG + Intergenic
1090616120 11:128516916-128516938 GGGAAGAAATGGGCAGAATCTGG + Intronic
1092952581 12:13521096-13521118 GGGAAGGACTTGTAACAATAGGG + Intergenic
1093074595 12:14744844-14744866 GGGAAAAATTAGAGAGAATATGG + Intergenic
1093181880 12:15976164-15976186 GGGAAGAAGGGGTATAAATATGG - Intronic
1094113266 12:26883678-26883700 GTCAAGAAATGGTAAGAATAAGG + Intergenic
1095612441 12:44145934-44145956 GGGAAGAATTGGATAGAATTGGG - Intronic
1096418966 12:51439716-51439738 AGAAAGACTTGGTAAGAAAAGGG + Intronic
1098085026 12:66833339-66833361 GGGAAGAGTGGCTAAAAATATGG - Intergenic
1098778738 12:74655951-74655973 GGTAAGTGTTGGTGAGAATATGG + Intergenic
1101520374 12:105476796-105476818 AGCAAGTGTTGGTAAGAATATGG - Intergenic
1101677581 12:106932250-106932272 GGTAAGAATGGGTAAGAATGAGG - Intergenic
1101951260 12:109177581-109177603 GGGAAGAATTGATATTAAAAGGG + Intronic
1102103669 12:110301382-110301404 GGGAAGGACTGGCAAGAATCAGG - Intronic
1102315561 12:111884531-111884553 GGGAAGATTTAGTCAGAATTAGG + Intronic
1102419431 12:112792206-112792228 GGGAGGAGTTGGCAAGAATTTGG + Exonic
1102795081 12:115682162-115682184 TGTAAGAATTGGTAAGAAGATGG + Intergenic
1102828853 12:115976088-115976110 AGAAAATATTGGTAAGAATATGG + Intronic
1104165847 12:126229091-126229113 GGGAAGAATTTCTAAGCAGAGGG + Intergenic
1106363907 13:29059429-29059451 GGGCTGATTTGGTAAGGATATGG - Intronic
1107987362 13:45786907-45786929 TGGAGAAATTGGAAAGAATAGGG - Intronic
1108027353 13:46191931-46191953 GGTAAGCATTGGCAAGGATATGG + Intronic
1108969847 13:56360058-56360080 GGTAATAAATGGAAAGAATAGGG + Intergenic
1109033235 13:57220775-57220797 AGGAAAAAGTGGAAAGAATAAGG - Intergenic
1112798141 13:103080074-103080096 GGGAAGAAATGTTAAGGAGAAGG - Intergenic
1112819289 13:103312188-103312210 AGGAAGAATTTTTAAGAACAAGG - Intergenic
1112908403 13:104452450-104452472 GGGAAAAATGGTAAAGAATATGG + Intergenic
1113628852 13:111866477-111866499 GACAATAATTGGTAAGAAAAAGG + Intergenic
1114490418 14:23097420-23097442 GGGAAGAATGGGTTTGAAAAAGG + Intronic
1114522974 14:23350423-23350445 GGGAATAATCAGTAAGGATAAGG + Intronic
1114577342 14:23726609-23726631 GGGAACATTTGGAAAGAATGTGG + Intergenic
1115651639 14:35406132-35406154 GGGAAGGATTGGTTAGTACAAGG - Intergenic
1116152671 14:41161450-41161472 GGGAAGAAATGGTAAATTTACGG + Intergenic
1116334292 14:43637938-43637960 GTGAAGAATTGGAAGGATTAGGG - Intergenic
1117089936 14:52239363-52239385 GGGAAGAAGTAGGAAGAAGAGGG + Intergenic
1117622933 14:57606721-57606743 GGGAGGAATTTGTAAGCAGAGGG - Intronic
1119348711 14:73946765-73946787 GGGAGGAATTTTTAAAAATAAGG + Intronic
1121163958 14:91774138-91774160 GAGGAGAATTGTTAAAAATAAGG + Intronic
1124014950 15:25866106-25866128 GGGAAGAAATGGTAAGCACGGGG + Intergenic
1125323565 15:38513805-38513827 GGGAAGAGTTGGAAATAATTGGG - Intronic
1125347787 15:38736545-38736567 GTGATAAATTGGTAAGAAAAAGG + Intergenic
1125898038 15:43319097-43319119 GGGAAGGATAGGGAAGGATAGGG - Intergenic
1125928688 15:43584346-43584368 AGGATGAAGTGGTAAGAATGGGG - Exonic
1125941854 15:43684181-43684203 AGGATGAAGTGGTAAGAATGGGG - Intergenic
1126260596 15:46685156-46685178 GTCAAATATTGGTAAGAATATGG + Intergenic
1127001315 15:54510261-54510283 GGGAAGATTTGGTGTGAATCTGG - Intronic
1127351039 15:58152644-58152666 AGTAATAATTGGTAAGATTAAGG - Intronic
1129728024 15:77911525-77911547 GGGAAGGGTTGGTAAGAACATGG + Intergenic
1130853178 15:87817939-87817961 GGGAAGAGTTGGAGAGAATTAGG + Intergenic
1131953828 15:97710211-97710233 AAGAACAATTGGCAAGAATAGGG + Intergenic
1131960422 15:97784706-97784728 AGGAAGAATTGGGAAGTATGAGG - Intergenic
1132110977 15:99102289-99102311 GGGAAGTATTGGCAAGAGAAGGG + Intronic
1132139863 15:99383436-99383458 GGGAAGACCTGGGAAGAATGGGG + Intronic
1132349194 15:101128000-101128022 GCGAAGAATTGGCAGGACTATGG + Intergenic
1132487988 16:206713-206735 GGAAAGAATTGGTAAGGAAATGG - Intronic
1133901699 16:9981502-9981524 GGAGAACATTGGTAAGAATATGG - Intronic
1133992687 16:10721432-10721454 GATAATAATTGGTAAGATTAAGG + Intergenic
1135818943 16:25662222-25662244 GGGCAGACTGGGTAAGAAAATGG + Intergenic
1135995925 16:27248314-27248336 GGCAAGTATTGGTGAGAACATGG - Intronic
1136054220 16:27676095-27676117 GGGAAGAATTGTTAAGGAAAAGG - Intronic
1137908829 16:52354565-52354587 GGGAACAATTGGGAAATATAGGG + Intergenic
1138721309 16:59083516-59083538 ATGAAGTATTGGCAAGAATATGG - Intergenic
1139711668 16:68780987-68781009 GGCCAGAATTGGGAAGATTAAGG + Intronic
1140127388 16:72129471-72129493 GGGAAGAATTGGTAAGAAAGTGG - Intronic
1140529756 16:75654628-75654650 GAGAAAAATTGGGTAGAATAGGG + Intronic
1141041129 16:80673642-80673664 GGGAAGAAAGGGTATGCATATGG - Intronic
1141798058 16:86287692-86287714 GGGAAAAATTCCTAAGAAAATGG + Intergenic
1144329799 17:14213188-14213210 GGGAAGAACTGGGAAGACCAGGG + Intergenic
1146924638 17:36735918-36735940 GGTAATAATTGGTAATAATGGGG + Intergenic
1147129111 17:38395680-38395702 GAGTAGAAGTGGTAAGAGTAAGG + Intronic
1147700436 17:42390619-42390641 TGGAAGAATAGGATAGAATAAGG - Intergenic
1148522147 17:48288001-48288023 GAGAAAAATTGGTAAAAACATGG + Intronic
1148659776 17:49320100-49320122 GGGAAGAGTTGGGAACAATAAGG - Intronic
1149084603 17:52700071-52700093 GGAAAGAATATGTAAGAAAAAGG - Intergenic
1149205467 17:54239752-54239774 GGATAGAATTTGGAAGAATAGGG + Intergenic
1149272390 17:54994377-54994399 GGGAAGAGTTGAGCAGAATATGG - Intronic
1150872305 17:68926363-68926385 AGGAAGAATTAGTAAGCACAAGG + Intronic
1157719839 18:49915276-49915298 GGGGAGAATAGGGCAGAATAGGG - Intronic
1158879156 18:61760135-61760157 GGGAAGAAGAAATAAGAATATGG - Intergenic
1159471614 18:68864856-68864878 AGGAATATTTGGAAAGAATAAGG - Intronic
1160965686 19:1746070-1746092 GGGAAGAATGGGGAAGGATGGGG + Intergenic
1160965717 19:1746151-1746173 GGGAAGAATGGGGAAGGATGGGG + Intergenic
1163751157 19:19078667-19078689 GGGAAGGATCCGTAAGAAAAGGG + Intronic
1165043308 19:33084368-33084390 GGAAAGAATAGGTAAGTATCTGG - Intronic
1168154946 19:54468261-54468283 GGGAAGTATTGGTGATAATATGG + Intronic
1168464869 19:56594537-56594559 GGAAAGAATGGGTAAGGAGAGGG - Intergenic
1168666523 19:58209130-58209152 GGGCAGAAGAGGTAAGAATGAGG - Intronic
925774524 2:7321226-7321248 TGGAAGAATTGTGAGGAATAAGG - Intergenic
926645102 2:15282452-15282474 TGCAAGAATGGGTAAGAACAAGG - Intronic
926871197 2:17419719-17419741 GTGAAAAATAGGTCAGAATAGGG - Intergenic
928285575 2:29987371-29987393 GGGAAGAATTACTTAGAATCAGG + Intergenic
928498148 2:31856591-31856613 GGGAAGAATTGGGTAGAAGCTGG + Intergenic
930219971 2:48736341-48736363 GGTAAGAATTGATAGGAAGAAGG - Intronic
930906274 2:56572171-56572193 GGTAAGAAGTGGTCATAATATGG + Intergenic
931613495 2:64130109-64130131 GGGAAAAGTTGGGAAGAATCTGG - Intronic
932898426 2:75668569-75668591 TTGAAGAATTTTTAAGAATATGG - Intronic
933941071 2:87245627-87245649 GAGAAGAATGTGCAAGAATAAGG - Intergenic
934093643 2:88577711-88577733 TGGAACAAAGGGTAAGAATAGGG - Intronic
934586267 2:95499561-95499583 GGAAAGAATTGTAAACAATAAGG - Intergenic
935505788 2:103900466-103900488 GGGAAGAATGGGAAAGAACTTGG - Intergenic
936116542 2:109707404-109707426 GGGAAGCAGTGCTAAGATTATGG + Intergenic
936352069 2:111720385-111720407 GAGAAGAATGTGCAAGAATAAGG + Intergenic
936712213 2:115144262-115144284 GGGAAGCATGGGTCAGAATAAGG - Intronic
936940661 2:117880939-117880961 GAGAAGTGTTGGTAAGGATATGG - Intergenic
937544831 2:123004337-123004359 GGGAAGAGCTTGTAAGAATGGGG - Intergenic
938605963 2:132893155-132893177 GGCAAGCGTTGGTAAGAATGTGG + Intronic
939589727 2:144049493-144049515 GTAAATAATTGGTAAAAATAAGG + Intronic
940221443 2:151356026-151356048 GAAAAGAATTGGAAAGACTATGG + Intergenic
941474607 2:165934768-165934790 GGCCAGAATTGGTGAGGATAAGG + Intronic
942377028 2:175348056-175348078 GGGAAGTTTTGGTAGGAGTAAGG - Intergenic
942537394 2:176979350-176979372 GGGAAGAATTGGTAAAATTTCGG - Intergenic
942950660 2:181717445-181717467 GGGGAGAATTAGAAAGAAGAGGG - Intergenic
943004420 2:182372291-182372313 GAGAAGTATTGGTAAAAATGTGG + Intronic
943197459 2:184772761-184772783 GGGAAAGGTTGGTAAGGATATGG - Intronic
943646629 2:190413288-190413310 GGGTAGAATGGGGGAGAATAGGG + Intronic
943787377 2:191893025-191893047 GACAAGTATTGATAAGAATATGG - Intergenic
944981656 2:205127659-205127681 GGGAAAAATGGGTAAGATGATGG - Intronic
945743675 2:213694323-213694345 GGGAGGAAGTAGTAAGAAAAAGG - Intronic
946266562 2:218548187-218548209 GGGAAGAATTAGTGGGAAAAGGG - Intronic
947143003 2:227036942-227036964 GACAAGAACTGGAAAGAATATGG - Intronic
1172725875 20:37041087-37041109 AGGAGGAATTGGAAAGAAGATGG - Intronic
1172729577 20:37074560-37074582 AAGAAGAATTGGCAAGAATGTGG + Intronic
1172793939 20:37524355-37524377 GGTAAGCATTCCTAAGAATACGG - Intronic
1173144455 20:40512599-40512621 GAGATGAATGGGTAAGAAGATGG - Intergenic
1174005189 20:47405018-47405040 GTGAAGAGATGGAAAGAATAAGG - Intergenic
1174139166 20:48400726-48400748 GGGAAGAGTTGGTGAGAGTGAGG - Intergenic
1174764231 20:53236910-53236932 GGGAGGAATTGATTAGATTATGG - Intronic
1177350209 21:19929233-19929255 GAAAAAAATTGGTCAGAATATGG + Intergenic
1177939027 21:27386042-27386064 GGGAAGAATCGGGAGAAATAAGG - Intergenic
1178105091 21:29309416-29309438 GGGAAGAATAGGTAAAACTGAGG - Intronic
1178379306 21:32094536-32094558 GGGAAGAATTGAGGAGAAGAGGG - Intergenic
1178456802 21:32762320-32762342 AGAAACAAATGGTAAGAATATGG + Intronic
1182066067 22:27432542-27432564 GGGCTGAATTGGTAAGAAGTTGG - Intergenic
1182719190 22:32384064-32384086 GGTAGGAACAGGTAAGAATAGGG + Intergenic
1184614804 22:45630770-45630792 GGGCAGTATTGATAAGAATGGGG + Intergenic
949199151 3:1351728-1351750 AGGAAGAAGTAGAAAGAATAAGG - Intronic
949928900 3:9063003-9063025 AGGAAGTATTGGTGAGAATGTGG - Intronic
951031285 3:17884854-17884876 TGGAAGAAATGGTAAGAATATGG - Intronic
951870092 3:27352065-27352087 GGGCAGGATTGGGAAGAGTAAGG + Intronic
951938230 3:28047516-28047538 TGAAAGAATTGGTAAAAATTTGG - Intergenic
951955530 3:28249121-28249143 GGAAAAAATTGCTAAGAATGTGG + Intronic
952021021 3:29020158-29020180 GGGAAGAAATGAAAAGTATAAGG - Intergenic
952165633 3:30745900-30745922 AAGAAGAAATGGAAAGAATAAGG - Intronic
952798701 3:37267847-37267869 GTGAAGACTTGGTATGCATATGG + Intronic
953586818 3:44208826-44208848 GGTAAGTATTGGTGAGTATATGG + Intergenic
953660845 3:44890533-44890555 GGGAAGCATTTGTAAGATTTGGG + Intronic
956411134 3:68980967-68980989 GGGAAGAAATGGAAAGAACTGGG - Intronic
956913028 3:73840774-73840796 ACGAAGTATTGGTAAGGATATGG + Intergenic
957417613 3:79927151-79927173 GTGAATAATTGGGAAGAATAAGG + Intergenic
957971448 3:87388082-87388104 GTGAAGAATAGGTAAAAATCAGG + Intergenic
958600718 3:96293332-96293354 GGGAAGAAATTGTCAGAATGTGG + Intergenic
958950432 3:100410190-100410212 GGGAAGTGTTGGTAGAAATATGG + Intronic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
959957977 3:112260921-112260943 GGGAAGAATTGTGTAGAAAAAGG - Intronic
960913705 3:122676166-122676188 AGGAAGACATGGCAAGAATATGG - Intergenic
960914740 3:122683725-122683747 GAGAACAGTTGGTAATAATATGG - Intronic
961509493 3:127392181-127392203 GAGATGAGTTGGTAAGAAAAGGG + Intergenic
961736004 3:129002515-129002537 TGGAATAGGTGGTAAGAATAGGG - Intronic
964838853 3:160971720-160971742 GGCAAGAATTGGTCTGTATAAGG - Intronic
964888289 3:161509653-161509675 AGGCAGAATTGGGTAGAATAGGG - Intergenic
965301096 3:167005892-167005914 GGGAAGACTTTCTAAGAAGAAGG - Intergenic
965453722 3:168871176-168871198 GTGAATAATTGGTAAGAAGGGGG + Intergenic
967654374 3:192029067-192029089 GGGAAGAATTGGGTAGCACATGG + Intergenic
968242059 3:197098841-197098863 GTGAGGAATTGTTAAGAGTAAGG - Intronic
969175777 4:5398044-5398066 GAGAATAATTGGTAAGATAATGG - Intronic
969921898 4:10548130-10548152 GGCAAGTGTTGGCAAGAATATGG - Intronic
970272441 4:14361591-14361613 GGTAAGACTTGGTAAGACTGTGG - Intergenic
970988953 4:22191113-22191135 GGGAAATATTGGTTAGAAGAGGG + Intergenic
971766601 4:30840294-30840316 GAAAAGAAGTGGAAAGAATAAGG - Intronic
971826855 4:31634658-31634680 TGGGAGAATTGGCAAGAGTAGGG - Intergenic
972368539 4:38398677-38398699 GATAAGCATTGGTAAGAATATGG - Intergenic
972448005 4:39165494-39165516 GGGAAGAAATGGTGAAAAAAAGG + Intergenic
973565260 4:52180009-52180031 GGGTAGAGTTTGTAAGACTAAGG + Intergenic
974245591 4:59312336-59312358 GGAGAGAATTGGTCAGAATCAGG - Intergenic
974860476 4:67514814-67514836 GGGAAAGATTTGTAAGATTAAGG - Intronic
975278542 4:72532823-72532845 GAAAAGAAATGGTAAAAATACGG + Intronic
975609142 4:76186568-76186590 GAGAAGAAGTGGTAAGAGCAGGG + Intronic
975869106 4:78758523-78758545 GGGTAGAACTGGTAACTATATGG + Intergenic
976275181 4:83269320-83269342 ACAAAGAATTGGTAAAAATATGG + Intronic
977272092 4:94929660-94929682 GGGAAGAATGAGCCAGAATAGGG - Intronic
979666184 4:123313227-123313249 TGGAAGAATTGAAAAGAATCTGG - Intronic
980453592 4:133009209-133009231 ATGAAGAATTGCTAAGAACAAGG - Intergenic
981157223 4:141453132-141453154 GACAAGTATTGGTGAGAATATGG - Intergenic
982264223 4:153523515-153523537 GGTAAGACTTGGTAAAAAGAAGG + Intronic
982371592 4:154639249-154639271 TGGAAGAAGTGGGAAGAATCTGG + Intronic
983322331 4:166211220-166211242 GGGAGAAATTGGCCAGAATAAGG + Intergenic
983504689 4:168540108-168540130 GGGATGACTTGGTCATAATACGG - Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
985204393 4:187519228-187519250 ATGAAATATTGGTAAGAATATGG + Intergenic
986367332 5:7045697-7045719 GGGAACTACTGGTAAGAATCTGG - Intergenic
987585907 5:19855916-19855938 GGGAAGGATTTGGAAGAAAATGG + Intronic
989122478 5:38018437-38018459 GGGAAGAAATGATGAGAATTGGG - Intergenic
990532864 5:56691026-56691048 GGGAAGAATAGGGATGAAAAAGG + Intergenic
990644158 5:57824898-57824920 GGGACGAATTTGTAGGAGTATGG - Intergenic
991173128 5:63652189-63652211 GGGAAAAATTACTAAGTATAAGG - Intergenic
992485453 5:77190112-77190134 GAGAAGAATTAATAAGAACATGG - Intergenic
993071398 5:83168277-83168299 GGAAATAAGTGCTAAGAATAGGG + Intronic
993345810 5:86780750-86780772 GGTAAGTATTGGCAAGGATATGG + Intergenic
993802588 5:92361473-92361495 GGAAATAATTAGTTAGAATAAGG - Intergenic
993842562 5:92898746-92898768 GAGAAGAAGTGGAAAAAATAGGG - Intergenic
994206861 5:97045008-97045030 GGGAAGAGAGGGAAAGAATACGG + Intergenic
994430754 5:99657583-99657605 GGGGAGAAGTGGTAAAAATTAGG + Intergenic
994964326 5:106648568-106648590 CAGAATACTTGGTAAGAATAAGG - Intergenic
997026571 5:130069815-130069837 AGAAAGAATTGGTAAGAAGAAGG - Intronic
997536189 5:134623843-134623865 GTAAAGAATAGTTAAGAATATGG - Intronic
997700533 5:135895276-135895298 GGGAATAATTTGTAACAATGTGG + Intronic
997792571 5:136774051-136774073 AGTAAGAATTGGTAAGAACCAGG + Intergenic
998591604 5:143485054-143485076 GGCAAGAATCAGTCAGAATATGG + Intergenic
999590359 5:153138218-153138240 GGGAAGACATGGTAAGGGTAGGG + Intergenic
1000143167 5:158426413-158426435 GGGGAAAATTGGCAAGAAGAGGG - Intergenic
1000735277 5:164891481-164891503 GAGAAGCATGGGCAAGAATAAGG - Intergenic
1000825377 5:166038052-166038074 GGGAAAAACTGGCAAGAAGAGGG + Intergenic
1002356433 5:178633026-178633048 GGCAAGAATTATTATGAATAAGG - Intergenic
1003087533 6:3072762-3072784 GGCAAGAAGTTGGAAGAATATGG + Intronic
1003561219 6:7182171-7182193 TGGAAGAATTGGGAATAAAACGG + Intronic
1004163173 6:13232565-13232587 TGGAAGAATGTCTAAGAATAAGG - Intronic
1004463804 6:15864521-15864543 GTGATGAAGTGGAAAGAATAAGG - Intergenic
1005399492 6:25416988-25417010 AGGGAGAAATGGTGAGAATAGGG + Intronic
1005515389 6:26549777-26549799 TGGAAGAGTTGGAAAGAAGAGGG + Intergenic
1006666327 6:35696932-35696954 GCCAAGCATTGGTGAGAATATGG + Intronic
1008151915 6:47963335-47963357 GATAAGTCTTGGTAAGAATATGG + Intronic
1008951906 6:57171030-57171052 CGGTAGAATTGGGAAGAATCTGG + Intergenic
1009053496 6:58307047-58307069 GGGAAGAAGTGGTGAAAGTAGGG + Intergenic
1010162902 6:72879266-72879288 ATCAAGTATTGGTAAGAATAAGG - Intronic
1010253104 6:73728915-73728937 GTGAAGAATTGGGAACAATATGG + Intronic
1010276108 6:73970421-73970443 GGGAAGAAAAGGTCAGTATAGGG - Intergenic
1010889611 6:81290455-81290477 GGGAACAATTGGAAAGAAGAGGG - Intergenic
1011080948 6:83489778-83489800 GGGAGAAATTGGAAAGAAGAAGG + Intergenic
1011785812 6:90843598-90843620 GTGAATAATGGTTAAGAATAAGG + Intergenic
1011852041 6:91641042-91641064 GGGAGGGACTGGCAAGAATAGGG - Intergenic
1012924809 6:105256604-105256626 GGGAAGCATTGTTAAGAATTAGG - Intergenic
1013202508 6:107913386-107913408 CGGAAAAATTGGGAAGAATTTGG - Exonic
1013595156 6:111654012-111654034 GGGAGGAAATGGTAAGCAAATGG - Intergenic
1014786441 6:125625149-125625171 GGGAAAAAATGGTAGGAACAAGG - Intergenic
1015000956 6:128214705-128214727 GTGAAGAATTGGAAAGAACGTGG + Intronic
1016122190 6:140357940-140357962 GGGAAAAATTGGTCACAAAAGGG + Intergenic
1016299832 6:142618403-142618425 GGGAAGATGTGGTGAGAAAACGG - Intergenic
1016534039 6:145090958-145090980 GGGAAGTATTGGGTAGAAGAGGG - Intergenic
1016630170 6:146220626-146220648 AGGAAGAATGGGTAAGAGGAAGG - Intronic
1017318352 6:153058982-153059004 GTGAATAATTACTAAGAATATGG + Intronic
1018249874 6:161858702-161858724 GGGGAGCATGGGTTAGAATAAGG - Intronic
1019549234 7:1593972-1593994 GGGAAGAAGGGGGAAGAAAAGGG - Intergenic
1020343038 7:7133259-7133281 GGGAAGAAAGGGATAGAATAAGG + Intergenic
1020352211 7:7233377-7233399 GGGAAGAATTGGTAAGAATAAGG - Intronic
1020797202 7:12690009-12690031 AGGAAGAAATGGTAACAGTATGG + Exonic
1021607631 7:22424809-22424831 GTGAAGAGTTGATAATAATATGG + Intronic
1021618552 7:22528096-22528118 GGTAAGAATTGGTGAGGACAGGG - Intronic
1022291880 7:29012985-29013007 GGGAAGAATGGCAAAGAATCTGG - Intronic
1023140476 7:37097138-37097160 GGTAAGATCTTGTAAGAATATGG - Intronic
1023294887 7:38704301-38704323 GGGAAGAGTTGGTAAATATTAGG - Intergenic
1023980204 7:45065158-45065180 GGGCAGAATTGGGCAGAATTGGG + Intronic
1024523850 7:50331309-50331331 AGGAAGAATTTGTTAGAATAGGG + Intronic
1024557776 7:50618129-50618151 GGGAAGAAATTCTAAGAAAATGG + Exonic
1024655005 7:51444922-51444944 GGGAAAGATTGGTGAGAAAAAGG + Intergenic
1028530232 7:91830737-91830759 GTGGAGTATTGGTAAGGATAGGG - Intronic
1030157021 7:106465614-106465636 TGGAAGAATTGGAAAGGAGAGGG + Intergenic
1030327005 7:108230276-108230298 GGTAAGAAATGGTAAGATTCTGG - Intronic
1030744135 7:113144631-113144653 GGGATGTATTGGGAAGAATCTGG + Intergenic
1031155846 7:118111224-118111246 GGGGAGAAGTGGTAGGATTATGG - Intergenic
1032984910 7:137327223-137327245 GAAAAGAATTGGTAAAAGTAAGG - Intronic
1033015912 7:137671355-137671377 GTCATGACTTGGTAAGAATATGG + Intronic
1033890224 7:146003340-146003362 GGCAAGATTGGGGAAGAATATGG - Intergenic
1037394290 8:18425865-18425887 TGGAATGATGGGTAAGAATAGGG - Intergenic
1037648740 8:20817463-20817485 GAAAAGATTTGGTAAAAATAGGG + Intergenic
1038925457 8:32134496-32134518 TGTAAGAATTGGCAGGAATAGGG - Intronic
1039670845 8:39595943-39595965 GGGAAGAACTTGGAAGAATGAGG + Intronic
1040095396 8:43437598-43437620 GAAAATAATTGGTAAGAAAAGGG - Intergenic
1043018716 8:74973321-74973343 GGGAATAATTTCTCAGAATATGG + Intergenic
1043655989 8:82665616-82665638 GAGAAGAAATGGGAAGAAAAGGG + Intergenic
1044139989 8:88638406-88638428 GAGAAGAATTGCAAAGAATAAGG + Intergenic
1044242608 8:89903491-89903513 GTGAAGAATGGTTAAGCATAGGG + Intronic
1044380801 8:91530898-91530920 AGGAAGAATTGGGATGAATTAGG + Intergenic
1044458369 8:92415620-92415642 GGAAAGAATTTGTGAAAATAAGG + Intergenic
1044532806 8:93326972-93326994 GGAAAGATTTGGTAAGTCTAAGG - Intergenic
1045343508 8:101274433-101274455 GAGAAGAACAGCTAAGAATATGG + Intergenic
1046439356 8:114237899-114237921 TGGAACAATTTGTAAGAATTTGG + Intergenic
1046800460 8:118420834-118420856 GGGAAGAAGAGATTAGAATAGGG + Intronic
1047410216 8:124618294-124618316 GGGAAAAATTGGTATGTAGAGGG - Intronic
1047803752 8:128337117-128337139 AGGAAGTATTGGCAAGAATGTGG - Intergenic
1049367372 8:142246952-142246974 GGGAAGGATTGGAGAGACTAAGG - Intronic
1049846877 8:144807092-144807114 GGGAAGACTTGGGAATAAAAAGG + Intronic
1051022550 9:12561810-12561832 GGGAGGAATTGGTGAGAATATGG + Intergenic
1051119940 9:13741874-13741896 GGGAAGACTTGGTGAGTTTAGGG + Intergenic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051464124 9:17356857-17356879 GGGAAAAAGTGGAAAGAATAAGG - Intronic
1052083368 9:24233942-24233964 GGGAAGAATTAGAAAAAGTAGGG + Intergenic
1052464711 9:28815848-28815870 AGAAAGAATTGGCAAGACTAAGG - Intergenic
1055524101 9:77112611-77112633 GGGAATAAATGGAATGAATAGGG + Intergenic
1057081774 9:92178905-92178927 GGGAAGAAATGGTCAGATTTGGG + Intergenic
1057116398 9:92526963-92526985 GGAAAGGTATGGTAAGAATATGG - Intronic
1057988009 9:99737428-99737450 GGGAAGAAGTGGTAAGATTCTGG - Intergenic
1058340971 9:103896011-103896033 GGGAAGAGTTAGTGAAAATAGGG - Intergenic
1058812477 9:108654481-108654503 GCCAAGAATTGGTATGAGTATGG - Intergenic
1058986528 9:110213160-110213182 GGGGAGAGTAGCTAAGAATAGGG - Intergenic
1059843453 9:118244045-118244067 GGCAAGAAGTGGCAAGAAAAAGG + Intergenic
1061726434 9:132584517-132584539 GGGAAGACTTGGTCCAAATAGGG - Intronic
1186226284 X:7402367-7402389 GGGAAGAATTTGTTATAATGTGG - Intergenic
1187217159 X:17288380-17288402 GGGAAGATTTGTTATGGATATGG - Intergenic
1187776323 X:22762458-22762480 AGCAAGAGTTGGTGAGAATATGG - Intergenic
1188919256 X:35951349-35951371 GAGAAGAATTGGTAAGTAAGTGG + Exonic
1189082475 X:37989628-37989650 GGGAAAAAGTGGAAAGAAAAAGG - Intronic
1190009655 X:46773382-46773404 GGTAAGTAGTGGTGAGAATATGG + Intergenic
1191826511 X:65371557-65371579 GGTAAGAATACTTAAGAATAAGG + Intronic
1192380499 X:70611620-70611642 GGCAAGACTTGTTAAGAACAGGG - Intronic
1192710770 X:73584116-73584138 GAGAATATTTGGTAAGAAAAAGG + Intronic
1194054024 X:89108499-89108521 GAGAAGTATTGGCAACAATAAGG - Intergenic
1194920385 X:99758315-99758337 GGGAAGAATGGGGAAGAATGTGG + Intergenic
1195029020 X:100908588-100908610 GGAAAGACATGGTAAGATTATGG + Intergenic
1195345942 X:103951403-103951425 TGGAAGAATTAGTTAGGATATGG + Intronic
1196089730 X:111726708-111726730 GGGAAGCATTGGAAAGTTTAAGG + Intronic
1196637401 X:118019191-118019213 GGGAAGAAATGGGAAGAAGAAGG - Intronic
1198145854 X:133857181-133857203 AGGAAGAATAGGTCAGAAGAAGG - Intronic
1198713561 X:139532089-139532111 GGAAAGGATAGATAAGAATAAGG + Intronic
1199206876 X:145159616-145159638 GGGAAAAATTGGTCAGAACAAGG + Intergenic
1199279930 X:145989619-145989641 GGGAAGCATTGGTGAGAGTGTGG - Intergenic
1201391190 Y:13499229-13499251 GGGAAGAATTTGGAGGATTAGGG - Intergenic
1201674153 Y:16560184-16560206 AGGAATCATTGGTAAGAATCAGG + Intergenic