ID: 1020355010

View in Genome Browser
Species Human (GRCh38)
Location 7:7266269-7266291
Sequence GGTCTCAATAGAACAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020355003_1020355010 15 Left 1020355003 7:7266231-7266253 CCTCCCCGACATGGGTAGGCATC No data
Right 1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG No data
1020355005_1020355010 11 Left 1020355005 7:7266235-7266257 CCCGACATGGGTAGGCATCATCT No data
Right 1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG No data
1020355002_1020355010 16 Left 1020355002 7:7266230-7266252 CCCTCCCCGACATGGGTAGGCAT No data
Right 1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG No data
1020355006_1020355010 10 Left 1020355006 7:7266236-7266258 CCGACATGGGTAGGCATCATCTA No data
Right 1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG No data
1020355004_1020355010 12 Left 1020355004 7:7266234-7266256 CCCCGACATGGGTAGGCATCATC No data
Right 1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020355010 Original CRISPR GGTCTCAATAGAACAAAAGG TGG Intergenic
No off target data available for this crispr