ID: 1020355390

View in Genome Browser
Species Human (GRCh38)
Location 7:7270008-7270030
Sequence AGGAAAAGTAGCCCCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020355384_1020355390 20 Left 1020355384 7:7269965-7269987 CCCTGGATACCAACATCTGATCA No data
Right 1020355390 7:7270008-7270030 AGGAAAAGTAGCCCCTGTGATGG No data
1020355387_1020355390 11 Left 1020355387 7:7269974-7269996 CCAACATCTGATCAAGTGGAAAA No data
Right 1020355390 7:7270008-7270030 AGGAAAAGTAGCCCCTGTGATGG No data
1020355385_1020355390 19 Left 1020355385 7:7269966-7269988 CCTGGATACCAACATCTGATCAA No data
Right 1020355390 7:7270008-7270030 AGGAAAAGTAGCCCCTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020355390 Original CRISPR AGGAAAAGTAGCCCCTGTGA TGG Intergenic
No off target data available for this crispr