ID: 1020363805

View in Genome Browser
Species Human (GRCh38)
Location 7:7358064-7358086
Sequence TCTCCCTATTACCACTTTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020363805 Original CRISPR TCTCCCTATTACCACTTTCA GGG Exonic
900698895 1:4031849-4031871 TCTCCCTAGCACCACTTCCTGGG - Intergenic
900828420 1:4945591-4945613 TCTGCCAATTCCCACCTTCATGG + Intergenic
905723564 1:40228622-40228644 CCTGCCTTTTACCACTTTAATGG + Intronic
907604558 1:55803773-55803795 TCTCCCTATGAGCAATCTCAGGG - Intergenic
908987744 1:70045328-70045350 TCTCCCTATGGCTAATTTCAAGG + Intronic
909182425 1:72440682-72440704 TCTCTTTAGTACCTCTTTCAGGG + Intergenic
910795454 1:91092966-91092988 TCTCCAAATCACCACTATCATGG - Intergenic
910976704 1:92914374-92914396 TCTTCCTATTTCCACTTTAAGGG - Intronic
914381121 1:147117387-147117409 TCTCCCTGTTCCCAGTGTCATGG - Intergenic
919263741 1:195235129-195235151 TTTACATATTACCACTTACAAGG + Intergenic
920571237 1:207019554-207019576 TCTGTCTAGCACCACTTTCAGGG + Exonic
1062843431 10:688392-688414 TTTCCTTTTTAACACTTTCAGGG - Intronic
1062889030 10:1042762-1042784 TCTCTGTATTACCATTTTCCAGG - Exonic
1066177595 10:32925467-32925489 TCTCCCTTTGAGCAATTTCAAGG + Intronic
1069053266 10:63816498-63816520 TCCTCCTAGTACTACTTTCACGG + Intergenic
1070199700 10:74191854-74191876 TGTAGCTATTACCACATTCAGGG + Intronic
1076518227 10:131062114-131062136 TGTCCCCTTTGCCACTTTCAGGG + Intergenic
1081138445 11:39468931-39468953 CATCCCTATTTCCAGTTTCAGGG - Intergenic
1081807406 11:45898008-45898030 TCTCCCTGTTACCTCTTCCAGGG - Intronic
1089059075 11:115611437-115611459 TCTCCCTCTCTCCACATTCAAGG - Intergenic
1090565941 11:127992427-127992449 TCTCCCTCTTAACCCTATCATGG - Intergenic
1090609317 11:128456102-128456124 TTTCCCTGTTTCCACTTTCCTGG - Intergenic
1090615978 11:128515533-128515555 TCTCTCAATTGCCAATTTCAGGG - Intronic
1090985315 11:131761137-131761159 CCTGCCTCTTGCCACTTTCACGG - Intronic
1091573739 12:1713725-1713747 TCTCCCAATTACCACTGAGAAGG + Intronic
1091708151 12:2714486-2714508 TTTCCCAATTCCAACTTTCAGGG - Intergenic
1092785497 12:12022757-12022779 CCTCCCTACTTCCTCTTTCATGG - Intergenic
1093436981 12:19147323-19147345 TCTCCTTAGTACCACTGTCTAGG - Intronic
1095113312 12:38322758-38322780 TCTCCCTATTCCCACATCCCCGG + Exonic
1098024194 12:66185507-66185529 TATCCCTATTACCATTTCAAAGG - Intergenic
1107549427 13:41461084-41461106 CCTTCCTGTTCCCACTTTCAGGG + Intronic
1108152622 13:47552094-47552116 TCTTCTTATTACCACTTTTTAGG + Intergenic
1110124943 13:71931204-71931226 CTTCCATATTACCACTATCATGG - Intergenic
1110231293 13:73170200-73170222 TCTCCCCACTAGCACCTTCATGG - Intergenic
1111514140 13:89305811-89305833 TCTACTGATTACCCCTTTCAAGG - Intergenic
1115587999 14:34834504-34834526 TCTCCCTAATTCCTCTGTCAGGG - Intronic
1117216454 14:53557406-53557428 TGTCCCCATTACAAGTTTCAGGG - Intergenic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1117879336 14:60295277-60295299 TCTCCTAATTTCCACTTTCTTGG + Intronic
1118711936 14:68526812-68526834 TCTCTCCTTTACCACTTTCGGGG - Intronic
1120646025 14:87075358-87075380 TCTGCCTATTACCATTGTGAAGG - Intergenic
1120939786 14:89936440-89936462 TATGCCTATTACCACTTAAAAGG + Intronic
1122027894 14:98891012-98891034 TTTACCTAATACCCCTTTCAAGG + Intergenic
1124352815 15:28970549-28970571 TCTTCCTATTACTATTTTTAAGG + Intronic
1124607586 15:31182238-31182260 TTTCCTTATTACCATTTTAATGG - Intergenic
1127705422 15:61542267-61542289 TCCCACTATTACCACTTTCTTGG - Intergenic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1130330957 15:82921926-82921948 TCTCCTTATTATCATTTTAATGG + Intronic
1131519564 15:93103269-93103291 TATCCCCATTCCCACATTCATGG - Intergenic
1131838550 15:96413936-96413958 TCTCCTTATTACCCCTCTCCAGG + Intergenic
1133483644 16:6196595-6196617 TTTCTCTATTTCCAGTTTCAGGG - Intronic
1136361435 16:29782482-29782504 CATCCCTGTTACCACTTTGAAGG + Exonic
1137024965 16:35464730-35464752 TATCCTTATTTCCTCTTTCATGG - Intergenic
1138066026 16:53942211-53942233 TCTCCTTACTTCCAGTTTCAAGG - Intronic
1141286107 16:82673578-82673600 TCTCCCTTTCATGACTTTCATGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1143676279 17:8435640-8435662 TCTCCCGAATAGCAGTTTCAGGG + Intronic
1155372274 18:25114119-25114141 TCTCCCTCCTCCCAATTTCAGGG + Intronic
1156726250 18:40131525-40131547 TCTCTCTGTTTCCATTTTCATGG - Intergenic
1158270627 18:55711315-55711337 TTTTACTTTTACCACTTTCAAGG + Intergenic
1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG + Intronic
1167531372 19:50019410-50019432 TCTCGCTAATACAACTTTCCAGG - Intronic
926207231 2:10842447-10842469 TCTCTTGATTACCACTTACAAGG + Intergenic
927036425 2:19181944-19181966 TCACCCTATTACCAAATCCAGGG - Intergenic
927465708 2:23334797-23334819 TCTTCCTATTATCTCTATCAAGG - Intergenic
929308438 2:40393875-40393897 TATGCCTATTACCCTTTTCATGG + Intronic
929471128 2:42194040-42194062 TTTCCCTTTTACCATTTTTAGGG + Intronic
931835387 2:66093671-66093693 TCTCCCTATTAGCAAATGCAGGG + Intergenic
937691588 2:124761972-124761994 TCTCTCCATTTCCATTTTCAAGG - Intronic
941012432 2:160316386-160316408 TCTCCCAAAAACCACTTTAAAGG + Intronic
941333935 2:164216563-164216585 TCACACTGTTACCAATTTCATGG + Intergenic
941900562 2:170674296-170674318 TCACCCTATTTTCACTTTTAAGG - Intergenic
942734853 2:179097641-179097663 TCACCTTGTTGCCACTTTCAGGG + Intergenic
943750275 2:191503262-191503284 GCTGCCCATTACCAGTTTCAGGG - Intergenic
1172857929 20:38022239-38022261 TCGCTCCTTTACCACTTTCAGGG + Intronic
1181286879 22:21758816-21758838 TCCTCCTATTACAACTTTCACGG + Exonic
1182939126 22:34257512-34257534 ACTCCCTTTTACCACTTTTTGGG + Intergenic
1184066063 22:42121992-42122014 TCTCCATATGATCATTTTCATGG + Intergenic
949342885 3:3048610-3048632 TCTCCCTAGTGTCACTTTTAGGG + Intronic
950172824 3:10851279-10851301 TCCTCCTATTGCCACTTTAAAGG + Intronic
952538756 3:34343873-34343895 TCTCTCAATTTCCACTTCCAAGG - Intergenic
953105136 3:39870244-39870266 TCTCCTTCTTCCCTCTTTCAGGG - Intronic
953585078 3:44192449-44192471 TCTCCATCTTACCTCTTTCTGGG - Intergenic
956824972 3:72989319-72989341 TATCCCTATTTCCCCTTTTAAGG + Intronic
959618713 3:108377046-108377068 TCTCCCTACTAGCTGTTTCATGG - Intronic
960415284 3:117377474-117377496 TCTCTCTACCATCACTTTCAGGG + Intergenic
964668094 3:159195543-159195565 TGTCCCTATTACAAGTTTCAGGG + Intronic
965454457 3:168880321-168880343 TTTCACTATTACAAGTTTCAAGG + Intergenic
965737585 3:171837933-171837955 TCTCCCTTTTGCCTCTTACATGG + Intergenic
969950597 4:10831357-10831379 TGTCCTTATTTCCACTTTCCGGG - Intergenic
971103827 4:23499377-23499399 TCTCCCTACCACCACTCTCTTGG + Intergenic
972730148 4:41786852-41786874 TCACCCTATTTCTACTTTCAAGG - Intergenic
973587035 4:52403566-52403588 TTTCCCTCTCACTACTTTCAAGG + Intergenic
975757730 4:77587707-77587729 TCTTCCTCTTACTAGTTTCATGG - Intronic
975792128 4:77964870-77964892 AATCACTATTACCACTTCCAAGG + Intergenic
977100444 4:92805941-92805963 TCTCCCTACTATCACCTTCCTGG + Intronic
987523634 5:19020051-19020073 TCTCCCTAACCCCACTTTCCAGG + Intergenic
989531267 5:42510766-42510788 TCTTCCTATGACCACTTTTGTGG - Intronic
993432635 5:87850641-87850663 TCTCCCTATTTGCACATGCATGG - Intergenic
993710151 5:91216403-91216425 TCACCCCATTACCACTTCCTGGG - Intergenic
994236220 5:97366100-97366122 TCTTCCCAATTCCACTTTCAGGG - Intergenic
995727643 5:115198678-115198700 TCTCAGTTTTACCACTTTCTTGG - Intergenic
997082670 5:130759031-130759053 TCTCAGTATTAATACTTTCAGGG - Intergenic
997737531 5:136224988-136225010 TGTCACTATTACCAGTTTGAGGG + Intronic
998568585 5:143237630-143237652 TCTGCCCATTACCACTGTAAAGG + Intergenic
999715469 5:154356650-154356672 TCTCCCTTCTCCCACCTTCAGGG - Intronic
1000388707 5:160700884-160700906 GCCCCCTATTACCTCTCTCATGG + Intronic
1005265840 6:24111372-24111394 TCTGCCCCTTACTACTTTCATGG + Intergenic
1007205504 6:40146800-40146822 ACACCCTTTCACCACTTTCAGGG - Intergenic
1007266130 6:40597397-40597419 TCTTCCTTTAACCACTCTCAAGG - Intergenic
1008463932 6:51808913-51808935 TCTCCCTATTGCCACTTTGCTGG + Intronic
1009594998 6:65723984-65724006 TATCCCTATTACATTTTTCAAGG - Intergenic
1009929465 6:70160033-70160055 TCTCCCTATTCCCACTACCCAGG + Intronic
1011215750 6:85004007-85004029 ACTCCCTTTTCCCACTTTCCAGG + Intergenic
1012069359 6:94593033-94593055 TCTCCCTATTATCAGCTTCTGGG - Intergenic
1013963528 6:115928598-115928620 TCTCAATATTAACAATTTCAAGG + Intergenic
1014271374 6:119340296-119340318 TGTCCCTAGTTCCTCTTTCACGG - Intronic
1014651886 6:124050013-124050035 TATCCCTATTCACAATTTCATGG - Intronic
1015300874 6:131651730-131651752 TCTCCCTCTTGCCCTTTTCAGGG - Intronic
1017233697 6:152098462-152098484 TCTCCCTGCAGCCACTTTCAGGG - Intronic
1018200241 6:161387799-161387821 TCTTCCCTTTACCACTTTAAAGG - Intronic
1018546320 6:164940814-164940836 TCTCCCTCTTGCCTCTGTCATGG - Intergenic
1018693619 6:166371122-166371144 TCTCCAACTTACCACTTTTAAGG - Intronic
1020363805 7:7358064-7358086 TCTCCCTATTACCACTTTCAGGG + Exonic
1021896853 7:25244617-25244639 TCTCCCTGTAGCCCCTTTCAGGG + Intergenic
1027140034 7:75650323-75650345 GCTCCAAATTACCACTTACAGGG - Intronic
1027601169 7:80243363-80243385 TCTCAATTTTACCACTTTAAGGG - Intergenic
1028096225 7:86764303-86764325 TCTACCTATTACAACTTCCTAGG - Intronic
1028690402 7:93643668-93643690 TCCCACTATTACCATTTTCCTGG + Intronic
1030911340 7:115252759-115252781 TGTACCTATTACCACCTCCAGGG - Intergenic
1031021233 7:116630111-116630133 TCTGCCTTTTAACCCTTTCATGG - Intergenic
1031060507 7:117046112-117046134 TCTTCCTTATACCACTTACAGGG - Intronic
1031505016 7:122571462-122571484 TTTCCTTATCACCACTTACAGGG - Intronic
1031885725 7:127244183-127244205 TATTCCTATTACCATTGTCAGGG + Intronic
1039169151 8:34722171-34722193 TCCCTCTCTTAACACTTTCATGG + Intergenic
1042424326 8:68629325-68629347 TCTCCATCTTACCACTTTTAGGG - Intronic
1043149722 8:76699862-76699884 TCTGCATAATACCACTTTGATGG + Intronic
1045368665 8:101499419-101499441 TCTCCCTAATGTCACTTTCCTGG + Intronic
1047106911 8:121742500-121742522 TCTTCCTATGAACACTTTCAAGG + Intergenic
1050301025 9:4259171-4259193 TCTCCATATTACCAGTTTCTAGG - Intronic
1054771699 9:69089732-69089754 CCTCCCTATTCCTCCTTTCAGGG - Intronic
1054799404 9:69332166-69332188 TCTCCCCATCACCACTCACAGGG + Intronic
1056287913 9:85110027-85110049 TCTTCCTGTTACCACTCTGAAGG + Intergenic
1057143166 9:92739605-92739627 TTTGCCTATTACCCCTCTCAAGG - Intronic
1058914595 9:109553503-109553525 TCTTCCTAGTAGCTCTTTCATGG + Intergenic
1061858451 9:133455762-133455784 CCTCCCTTTTACTACTATCAAGG + Intronic
1188364884 X:29303254-29303276 TCCCCGGATTACCACTATCATGG - Intronic
1188546937 X:31318134-31318156 TGCCTCTATTACTACTTTCATGG - Intronic
1191678587 X:63817481-63817503 TCTCTGTATTATCACTTGCAAGG - Intergenic
1194625504 X:96222007-96222029 TCTCTCTATCACTACTTTCATGG + Intergenic
1196275456 X:113761402-113761424 CATCCCTATTACAAGTTTCAGGG - Intergenic
1196498288 X:116348263-116348285 TCTCCCTATAAGCATTTACATGG + Intergenic
1196773242 X:119316644-119316666 TCTCCCTATTTTCACTTCCTAGG + Intergenic
1200882789 Y:8236673-8236695 TGTCTCCATTGCCACTTTCAAGG + Intergenic
1202117664 Y:21487121-21487143 TGTCCCCATTGCCACTTCCAAGG - Intergenic
1202200891 Y:22346280-22346302 TGTGCCCATTGCCACTTTCAAGG - Intronic