ID: 1020366287

View in Genome Browser
Species Human (GRCh38)
Location 7:7384206-7384228
Sequence AACCCAGTGCAGTAACATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020366287 Original CRISPR AACCCAGTGCAGTAACATAC TGG Intronic
903314475 1:22490753-22490775 AATTCAGTGCAGTACCGTACTGG + Intronic
906594398 1:47062300-47062322 GAACCACTGCAGGAACATACCGG + Intergenic
906794089 1:48682892-48682914 AACCCAGTGAGATAACATAAGGG + Intronic
908178560 1:61580653-61580675 TTCCCAGTGCAGTCACTTACTGG - Intergenic
916657387 1:166888175-166888197 AACACAGTGCTGTTACAGACTGG + Intergenic
918555185 1:185790775-185790797 AACCCAGGGCAGTATCACTCTGG - Intronic
923361424 1:233215495-233215517 AACCTAGAGCAGTGGCATACGGG + Intronic
1065758060 10:28952747-28952769 AAACCAGTGCAGGAAGATACTGG + Intergenic
1066617083 10:37306133-37306155 AACCCACTGCAGTAAATTACAGG - Intronic
1069870666 10:71530897-71530919 AACCCAGGGCAGTCACATTCTGG - Intronic
1071155497 10:82683952-82683974 AACTCAGTTCAGTAGCATGCAGG - Intronic
1075185036 10:120248266-120248288 AAACCAGATCAGTTACATACAGG - Intergenic
1080866628 11:36200988-36201010 AACAGAGTGCAGTAACAGAGGGG + Intronic
1080888488 11:36388193-36388215 GACCCTGTGCAGGAACATATGGG - Intronic
1081013713 11:37849087-37849109 AACACAGAGCAGTAATATAAGGG - Intergenic
1082682266 11:56189672-56189694 AACACAGTGCATTAAAATAATGG + Intergenic
1093097288 12:14985707-14985729 TACCCAGTGCTGAAACAAACAGG - Intergenic
1095518741 12:43037032-43037054 AACCCAGTACAGAAATATATGGG - Intergenic
1095583600 12:43827491-43827513 AACCCAGTGCTGTACAATGCTGG + Intergenic
1098537652 12:71612726-71612748 AAGCCAGTGCATTAGCATGCAGG + Intronic
1102212388 12:111136831-111136853 AAGTCAGTGCAGGAACTTACAGG + Intronic
1106026272 13:25958584-25958606 AACTCACTGCAGTAAATTACAGG - Intronic
1107047270 13:36006796-36006818 ACCCCAGTCAAGTAACTTACAGG + Intronic
1111194940 13:84862228-84862250 AACCAAGTGAAGTAAAATGCTGG - Intergenic
1111244663 13:85520263-85520285 AACACAGAGCAGTAACAGAGAGG + Intergenic
1115083939 14:29490889-29490911 AAACCTCTGCAGTGACATACTGG + Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1132769934 16:1556174-1556196 GACCCAGTGCAGCATCATGCAGG - Intronic
1135872804 16:26166430-26166452 AACCCAGTGGAATAACACAAAGG + Intergenic
1138703123 16:58886078-58886100 AGTCCAGTGCAGTAAGAAACTGG + Intergenic
1141707220 16:85673242-85673264 AACCCACTGTAGTAACAATCTGG - Exonic
1143225224 17:5296234-5296256 AACCCAATGCAGTACCAAAATGG - Intronic
1144038324 17:11387020-11387042 AACCCAGAGAAGTAGCATAAGGG + Intronic
1145014072 17:19385553-19385575 AACCCAGTCCTTTAACAAACTGG - Intronic
1145742264 17:27285303-27285325 AACTCAGGGCAGTTACATGCAGG - Intergenic
1148854298 17:50570298-50570320 AACCCATTGCAGTAACTGCCGGG + Intronic
1149089297 17:52759182-52759204 AATCCAGTGCTGTATAATACTGG - Intergenic
1149643398 17:58219888-58219910 AAGCCAGTGCAGTAACAAAGTGG - Intronic
1158227572 18:55216748-55216770 AAACCAGTGCAATAACGTCCTGG - Intergenic
925561004 2:5195463-5195485 AACCAAGTGCCGTCACAGACTGG + Intergenic
929730421 2:44485622-44485644 TATCCAGTACAGTAACATGCTGG - Intronic
931285287 2:60827091-60827113 ACTCCAGTGCAGTCACATAGTGG - Intergenic
931756424 2:65378692-65378714 AATCGAGTGCAGTTACTTACTGG - Intronic
935152328 2:100449287-100449309 AACCAAGTGTAGTAACATAATGG - Intergenic
942165026 2:173233252-173233274 AAGCCAATGCAGTAACCTAAAGG + Intronic
946257499 2:218456146-218456168 AACCCATTGAAGAAACATACAGG + Intronic
948195906 2:236096151-236096173 AAGCCAGTGAAGTTACCTACTGG - Intronic
1174885316 20:54327855-54327877 AACCCACTGCAGTAGCACATAGG + Intergenic
1176302694 21:5106099-5106121 GACCAAGTGCAGTCACACACAGG - Intergenic
1180655602 22:17418343-17418365 AGCGCAGTGCAGTAACACATAGG - Intronic
949187003 3:1203927-1203949 TACTCAGTACAGTAACATGCTGG + Intronic
949558004 3:5175495-5175517 AACATATTGCAGTAATATACTGG - Intronic
955822531 3:62911330-62911352 AACCCAGTGCTGTAATATTTTGG - Intergenic
964615454 3:158659527-158659549 AACCCACTGCAGGACCATATTGG + Intronic
966680479 3:182637209-182637231 AATGAAGTGCAGAAACATACAGG + Intergenic
975623092 4:76314454-76314476 GAGCCACTGCAGGAACATACTGG + Intronic
976384198 4:84436388-84436410 AACACACTGCATTAACATATTGG - Intergenic
977923863 4:102676372-102676394 AACCCAGTGAAGCATCTTACAGG + Intronic
979127431 4:116992417-116992439 CACACAGTGAAGTATCATACAGG + Intergenic
986441248 5:7783756-7783778 CACCCAGTGCAGTGACATCTTGG + Intronic
988202770 5:28089266-28089288 AAAGCAGTGCAGTAAAATAAGGG - Intergenic
989344633 5:40416146-40416168 AACCCAGTATACTAGCATACAGG - Intergenic
991666000 5:69000528-69000550 AAGGCAGTGCATTAACATAAAGG + Intergenic
993383157 5:87231624-87231646 CAGCCATTGCAGCAACATACAGG + Intergenic
998537682 5:142949811-142949833 AACCCTCTGCAGTGACATACAGG + Intronic
1008477624 6:51949404-51949426 AGCACAGTGCAGTAAGGTACAGG - Intronic
1008979015 6:57461984-57462006 ACCCAAGGGTAGTAACATACAGG + Intronic
1009167150 6:60354978-60355000 ACCCAAGGGTAGTAACATACAGG + Intergenic
1013691747 6:112652806-112652828 GACCCAGTGGAGTAACAGGCTGG - Intergenic
1018052858 6:160026709-160026731 AAACCTGTGCAGTAGCACACTGG + Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1020366287 7:7384206-7384228 AACCCAGTGCAGTAACATACTGG + Intronic
1024251559 7:47509465-47509487 GAGCAAGTGCAGTAACATACGGG - Intronic
1030863345 7:114666095-114666117 AACCCATAGCAGCAATATACTGG - Intronic
1031043709 7:116863753-116863775 AAGCCAGTGCAGGAAAATACAGG + Intronic
1032867770 7:135945019-135945041 TATTCAGTACAGTAACATACTGG - Intronic
1036234743 8:7028790-7028812 ATCCCCGTGCAGTTACTTACTGG + Intergenic
1037252481 8:16912870-16912892 AGCCCAGAGCAGTAAGACACTGG + Intergenic
1038134140 8:24767558-24767580 AACTCAGTGCACTGACTTACAGG + Intergenic
1045704463 8:104904985-104905007 TTACCAGTGCAGTACCATACAGG + Intronic
1046636049 8:116677250-116677272 AGCCCAGTGGAGTAAAATTCTGG - Intronic
1050110665 9:2212032-2212054 TACCTAGTCCAGTAACAGACTGG + Intergenic
1052026070 9:23574420-23574442 AAGTCAGAGTAGTAACATACTGG - Intergenic
1058798095 9:108517895-108517917 AGCCCAGGGCAATGACATACAGG - Intergenic
1061380990 9:130257531-130257553 AGCCCAGTGCAGTATCACAGGGG + Intergenic
1191841667 X:65517712-65517734 AGCCCTGGGCAGTAACATAGAGG - Intronic
1193186789 X:78522768-78522790 AAACCAGTGAAGGAAAATACAGG + Intergenic
1197354612 X:125422253-125422275 AATCCAGTGCAGGAAAATAGAGG + Intergenic
1200711261 Y:6486797-6486819 AACCCAGTGGGGTTCCATACTGG - Intergenic
1201520755 Y:14870930-14870952 AACCCAGCTCAGTAACAGAAAGG - Intergenic