ID: 1020371060

View in Genome Browser
Species Human (GRCh38)
Location 7:7432455-7432477
Sequence CAAAGGTAAGACTTTAAAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020371060_1020371072 26 Left 1020371060 7:7432455-7432477 CCTACTTTAAAGTCTTACCTTTG 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1020371072 7:7432504-7432526 CCCATCGGCCCAGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 18
4: 254
1020371060_1020371069 19 Left 1020371060 7:7432455-7432477 CCTACTTTAAAGTCTTACCTTTG 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1020371069 7:7432497-7432519 ACGTAAACCCATCGGCCCAGGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1020371060_1020371068 18 Left 1020371060 7:7432455-7432477 CCTACTTTAAAGTCTTACCTTTG 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1020371068 7:7432496-7432518 CACGTAAACCCATCGGCCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1020371060_1020371070 20 Left 1020371060 7:7432455-7432477 CCTACTTTAAAGTCTTACCTTTG 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1020371070 7:7432498-7432520 CGTAAACCCATCGGCCCAGGGGG 0: 1
1: 0
2: 1
3: 6
4: 152
1020371060_1020371067 17 Left 1020371060 7:7432455-7432477 CCTACTTTAAAGTCTTACCTTTG 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1020371067 7:7432495-7432517 CCACGTAAACCCATCGGCCCAGG 0: 1
1: 0
2: 0
3: 0
4: 30
1020371060_1020371064 11 Left 1020371060 7:7432455-7432477 CCTACTTTAAAGTCTTACCTTTG 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1020371064 7:7432489-7432511 CCCACTCCACGTAAACCCATCGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020371060 Original CRISPR CAAAGGTAAGACTTTAAAGT AGG (reversed) Exonic
902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG + Intronic
903571954 1:24312262-24312284 TAAATGGAAGACTTAAAAGTAGG + Intergenic
906018654 1:42607091-42607113 GAAAGTGAAGAATTTAAAGTTGG + Intronic
906220683 1:44076547-44076569 CAAATGTCAGACTTTAAAAATGG + Intergenic
908935181 1:69366984-69367006 TAAAGGTAAGACTTGAAACAAGG + Intergenic
909041422 1:70657163-70657185 CAAAGTTAAGTTTTGAAAGTTGG + Intergenic
913008460 1:114658608-114658630 CAAATGAAACATTTTAAAGTTGG + Intronic
913013102 1:114704322-114704344 CCAAGGTAATACTTTAAAGCAGG + Intergenic
913690563 1:121276006-121276028 CAAAGGTAAGACAGTAATCTTGG - Intronic
914146978 1:145003952-145003974 CAAAGGTAAGACAGTAATCTTGG + Intronic
914976150 1:152364678-152364700 CAAATGTATGACTTAAAAGCTGG - Intergenic
915394735 1:155574420-155574442 CAAAATTAAGAAATTAAAGTTGG - Intergenic
915702174 1:157806481-157806503 TAAAGGTAAGACTTTGAATCAGG + Intronic
918332634 1:183473681-183473703 AAAGGGGAAGACTTTAAAATTGG + Intronic
918424888 1:184398392-184398414 TAAAAGTCTGACTTTAAAGTAGG - Intronic
918691350 1:187483905-187483927 CAAAGGTAAGACTTGATGGCTGG - Intergenic
919615327 1:199800307-199800329 CAAAATGAAGACTTTAAAGATGG - Intergenic
919677232 1:200395521-200395543 CAAAGCCAAGATTTTAAATTAGG + Intergenic
920137102 1:203778785-203778807 CAAAGGTAAGAATTTCAAGATGG - Intergenic
920477882 1:206294495-206294517 CAAAGGTAAGACAGTAATCTTGG - Intronic
920504409 1:206506534-206506556 AAAAAGTAAGACTTTCAAGATGG + Intergenic
921643139 1:217580630-217580652 GAAAGGAAAGATTTTAAAGGAGG - Intronic
921923369 1:220691634-220691656 CAGGGGTAAAACTATAAAGTTGG + Intronic
922622888 1:227004448-227004470 GAAAAGGAAGACTTTTAAGTAGG - Intronic
922883009 1:228996793-228996815 CAAAGGTAATTCCTTTAAGTGGG - Intergenic
923889194 1:238192596-238192618 CAAAAGAACAACTTTAAAGTTGG - Intergenic
1062782484 10:227323-227345 GAAAGTTAAGACTTTAAAAATGG + Intronic
1063296946 10:4816039-4816061 CTAAGTTAGGACTTCAAAGTTGG - Intronic
1065304730 10:24357394-24357416 CAAAGGTAAGAATTTTAATAGGG - Intronic
1065851723 10:29795758-29795780 AAAAGGTAAGACATTAATGCTGG + Intergenic
1068238701 10:54274319-54274341 AAAATGTAAGACTACAAAGTGGG - Intronic
1069107944 10:64406603-64406625 CAAAGGAATAACTTTATAGTGGG + Intergenic
1069600293 10:69700954-69700976 CAAAACTAAGACATTAAGGTTGG + Intergenic
1070807803 10:79280745-79280767 CAAAGGTGAGACTCAAATGTGGG - Intronic
1071120798 10:82275716-82275738 GAAAGTTAATTCTTTAAAGTGGG - Intronic
1071440891 10:85692910-85692932 TAAAGGTAAGGCTGTAAAGGTGG + Intronic
1071708085 10:88021180-88021202 AAAAGGTAAGAATTAATAGTAGG + Intergenic
1072475410 10:95755500-95755522 CAAAGGTAGGAAGTCAAAGTTGG + Intronic
1073503091 10:103959969-103959991 CAAATGTAATACATAAAAGTAGG + Intergenic
1073902584 10:108240914-108240936 AAAAGTTAAGAATTTAAAGGAGG + Intergenic
1074028560 10:109662513-109662535 CAAATGAAATACTTTAAAATTGG - Intergenic
1076017085 10:127036315-127036337 CAAAGGGAAGAGTTAAAAATAGG - Intronic
1078675899 11:13413892-13413914 CAAAGGTAAGATTTGAATATAGG + Intronic
1079217589 11:18527341-18527363 CAAGTGTATGACTTTAGAGTCGG - Intergenic
1079568141 11:21908489-21908511 CAAAGGAATGAATTTAAAGAAGG - Intergenic
1079779233 11:24578439-24578461 CAAAGGTAGGATTTGAAACTTGG + Intronic
1085811462 11:79686235-79686257 TAAAGCATAGACTTTAAAGTTGG + Intergenic
1086439018 11:86809511-86809533 CTCTGGTATGACTTTAAAGTTGG - Exonic
1087245973 11:95837551-95837573 CAAAGGTATCACTGTTAAGTGGG - Intronic
1090150101 11:124374951-124374973 CAAAGGTTTGATTTTAAGGTAGG - Intergenic
1092886392 12:12927810-12927832 CAAAGGTCAGACTGTCCAGTGGG + Intergenic
1095149405 12:38773569-38773591 AAAAGGTAAGACTAAAATGTAGG + Intronic
1096272411 12:50176205-50176227 CAAAGTGAAGAGTTTAAAGGAGG - Exonic
1098412386 12:70200383-70200405 CAAACTGAAGACATTAAAGTTGG + Intergenic
1098679635 12:73335999-73336021 CAAAGCTAAGATTTGAACGTAGG - Intergenic
1099168250 12:79334015-79334037 CAAAGGTAAAAATATAAAGTAGG - Intronic
1100260934 12:92931553-92931575 CAAAGGGAAGATTGTAAAGTTGG - Intergenic
1102957616 12:117069589-117069611 CAAAAGTAAGGCCTTGAAGTGGG + Intronic
1104172558 12:126296328-126296350 CTCATGTAAGACTTTAAGGTAGG + Intergenic
1104234191 12:126917086-126917108 GAAAGGAAAGACTGTAAAATTGG + Intergenic
1104329124 12:127827671-127827693 CGAAAGAAAGACTTTAAAGAAGG - Intergenic
1107570201 13:41649324-41649346 AAAGAGTAAAACTTTAAAGTAGG - Intronic
1107935739 13:45343724-45343746 CAAAGGCAAGATTTTAATCTAGG - Intergenic
1110661512 13:78063434-78063456 AAAAGGGAAGCCATTAAAGTAGG - Intergenic
1110783996 13:79501632-79501654 CAAAGCAAAAACTCTAAAGTTGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112234132 13:97620168-97620190 TAAAGGTCAGAATTTAAAGTGGG - Intergenic
1112905008 13:104406684-104406706 CAATGGAAAGAATTTCAAGTAGG + Intergenic
1112926188 13:104678170-104678192 CAAAGGGCAGAACTTAAAGTTGG - Intergenic
1114151904 14:20050253-20050275 CAAAAATAAGACGTTAAACTAGG + Intergenic
1114824562 14:26061460-26061482 CAAAAGTATGACTTTACGGTGGG - Intergenic
1116656871 14:47665178-47665200 AACAGTTAAGACTTGAAAGTGGG - Intronic
1117364130 14:55008628-55008650 CAAAGGAAAGACTTAAAACAGGG + Exonic
1117364191 14:55009145-55009167 AAAAGGTAAGCCATTAAATTTGG - Intronic
1117450971 14:55849511-55849533 CATAGGTAAAAATATAAAGTTGG + Intergenic
1117805751 14:59489202-59489224 CAAAGGAATGACTTAAAAATTGG - Intronic
1117866004 14:60150047-60150069 CAAAGGTAAAAATTTCTAGTTGG - Exonic
1118884235 14:69853273-69853295 GAAAGGGAAGCCTTTAAGGTTGG + Intergenic
1120058480 14:79953814-79953836 CATAGGTAAGATTATAAAGTAGG + Intergenic
1120329999 14:83080034-83080056 CAAAGGAAAGCCATTAAAATGGG + Intergenic
1120426024 14:84349724-84349746 AAATTGTAAGAGTTTAAAGTAGG + Intergenic
1120662358 14:87265539-87265561 GATATGGAAGACTTTAAAGTGGG - Intergenic
1120699474 14:87682911-87682933 GAAAGGGAATGCTTTAAAGTGGG + Intergenic
1122170049 14:99865449-99865471 CAAAGGTAACATTTTACAGCAGG - Intronic
1124942432 15:34230585-34230607 CATAGGTAAGACTCAAAAGCGGG + Intronic
1125699881 15:41673028-41673050 CAAAAATAAGAGTTTAAAGTAGG - Intronic
1127136290 15:55927177-55927199 CTGAGCTAAGACTTGAAAGTTGG + Intronic
1127157643 15:56146059-56146081 CATATTTAAGACATTAAAGTGGG - Intronic
1136925164 16:34365268-34365290 CAGAGGGAAGACTTAAAGGTGGG + Intergenic
1136979409 16:35046538-35046560 CAGAGGGAAGACTTAAAGGTGGG - Intergenic
1137266538 16:46873652-46873674 CAAAGCTAAGACTTGAACTTAGG - Intergenic
1137491683 16:48938219-48938241 CAAAGGTCAGACCTCAAAGATGG - Intergenic
1138276543 16:55738985-55739007 CAAAGGTAAAACCTAAAATTAGG + Intergenic
1141779196 16:86147371-86147393 CAAAAGTAAAATTTTAAAGCTGG - Intergenic
1142484201 17:236206-236228 CAGAGGTAGGACATTAGAGTGGG - Intronic
1144609596 17:16698286-16698308 CAAAGGTGAGAATTTCAAGGAGG + Intronic
1144903176 17:18617265-18617287 CAAAGGTGAGAATTTCAAGGAGG - Intergenic
1144927890 17:18828719-18828741 CAAAGGTGAGAATTTCAAGGAGG + Intergenic
1145129395 17:20329485-20329507 CAAAGGTGAGAATTTCAAGGAGG + Intergenic
1146207256 17:30915490-30915512 CAAAAGTAAGACTTGAATTTAGG + Intronic
1148985211 17:51614830-51614852 TAAAGGTAAGACTTTGATTTGGG - Intergenic
1149233443 17:54563634-54563656 AAAACTTGAGACTTTAAAGTTGG + Intergenic
1155857766 18:30855112-30855134 CACAAGCAATACTTTAAAGTAGG - Intergenic
1155859440 18:30878477-30878499 CAAAGGTCAGACTTTAGAGGTGG - Intergenic
1155966096 18:32036865-32036887 GAAAAGTAAGAATTCAAAGTGGG - Intronic
1158235834 18:55312637-55312659 CAAAAGTGACACTGTAAAGTTGG + Intronic
1159590583 18:70331228-70331250 AAAAGGTAAAAATTTAAAGGTGG - Intergenic
1162870008 19:13579203-13579225 CAAAAGTCTGACTTTAAAGAAGG - Intronic
1163016262 19:14457107-14457129 CAAATGCAAAACTTTACAGTGGG + Intronic
1164961229 19:32431973-32431995 CAAATGAAATACTTTAAAATTGG - Intronic
1165926778 19:39331347-39331369 CAAAGATAAAACTATAAAGAAGG + Intronic
925875298 2:8306483-8306505 CAAAGATAAGATGTTAAAGCAGG + Intergenic
926102700 2:10129964-10129986 CACAGGACTGACTTTAAAGTTGG - Exonic
926937151 2:18097402-18097424 CAAAGGAATGCTTTTAAAGTTGG - Intronic
929317784 2:40501068-40501090 CAAAGGAAAGGCCTTGAAGTAGG - Intronic
929861343 2:45680498-45680520 CCAGGGTTAAACTTTAAAGTTGG + Intronic
929967488 2:46546197-46546219 CAAAGGAATGAATTTAAAATGGG + Intronic
930533903 2:52623390-52623412 CAAAGGTAGAACTTGAAAGAAGG - Intergenic
933091617 2:78126336-78126358 CAAATGGAAGCCTTAAAAGTGGG - Intergenic
933207307 2:79521882-79521904 CCAAGGGAACAATTTAAAGTGGG + Intronic
933394751 2:81716897-81716919 AAGAGATAAGACATTAAAGTTGG + Intergenic
936096106 2:109531349-109531371 CAAGGGTGAGACTTTACAGCTGG - Intergenic
937501091 2:122480173-122480195 CAAAGGTGTGATCTTAAAGTTGG - Intergenic
937506027 2:122537317-122537339 CAAAGCTAAGACCTGAAACTAGG - Intergenic
939448061 2:142335044-142335066 CAAAGAAATGACTTAAAAGTTGG - Intergenic
940084332 2:149841028-149841050 CAAAAGCAATACTTTAAAGCAGG + Intergenic
940200813 2:151148140-151148162 GAAATGTATGGCTTTAAAGTGGG - Intergenic
940280808 2:151987812-151987834 CAAAGGGAAGACATTTAAATTGG - Intronic
941013797 2:160331782-160331804 AAAAGGAAAGACTATAAAGCAGG + Intronic
942461866 2:176174225-176174247 CAATGTTAAGCCTTGAAAGTGGG - Intergenic
943380292 2:187136479-187136501 CAAAGGAAACACCTTAAAGATGG - Intergenic
943422600 2:187686235-187686257 CAAAGATCAGACTTTATAGTTGG + Intergenic
944069728 2:195655661-195655683 CAATGGTGAGACTTGAAACTAGG + Intronic
944147340 2:196520136-196520158 CAAAAGTAAGAATTCAACGTTGG - Intronic
944299748 2:198109968-198109990 CAAAGGAAAAACTATGAAGTAGG + Intronic
946947297 2:224834132-224834154 TAAAGGTAAGAATTTAAAGATGG - Exonic
948672741 2:239578890-239578912 CAAAGCTAAGACTTTCACCTTGG + Exonic
948695157 2:239729553-239729575 CAAAGGTAGGACTGGAAAGGAGG - Intergenic
1168959379 20:1858150-1858172 CTAAGATAAGACTTTGATGTTGG - Intergenic
1173003898 20:39125019-39125041 GAAAGGTGAGAATTTAAACTTGG + Intergenic
1173398069 20:42699613-42699635 CACAGGAAAGACTTTAGTGTGGG + Intronic
1174303405 20:49598547-49598569 CATAGGTAAGACATTTAAATGGG - Intergenic
1178029347 21:28506233-28506255 CAAAGAAATGACTTTCAAGTTGG - Intergenic
1178573838 21:33766862-33766884 CAAAGTTAAAAGTGTAAAGTGGG + Intronic
1181004639 22:20006955-20006977 CAAAGGTAAAAATTTAAGGCTGG + Intronic
1183069280 22:35385042-35385064 CAAAGTTAAGACATTTAGGTTGG - Intronic
1183826047 22:40388558-40388580 CAAAGGGAAGGTTTTAAAGATGG + Intronic
950057096 3:10033996-10034018 CAAAGCTAAGTCTTTTATGTGGG + Intronic
951108294 3:18771012-18771034 GAAAGGTAAGATCTGAAAGTCGG + Intergenic
952987081 3:38795094-38795116 CAAGGGAAAGTTTTTAAAGTTGG - Intergenic
953018047 3:39097182-39097204 TAAAGGTGAGACTTTCAACTAGG + Exonic
953831352 3:46300223-46300245 CAAAGCTCAGACTTTAAAGTAGG - Intergenic
956628366 3:71289525-71289547 TCAAGGTAAGTGTTTAAAGTAGG - Intronic
957263815 3:77934853-77934875 CAAAGATAACATTTTGAAGTAGG + Intergenic
960918345 3:122720657-122720679 CAAAGATATGGCTTTAAAATTGG + Intronic
963536903 3:146540821-146540843 GAAAGGTAGGAATTTCAAGTAGG + Intronic
963846982 3:150169288-150169310 CAAAGCTCAGACTCTGAAGTTGG - Intergenic
964774930 3:160264853-160264875 GAGAGGGAAGGCTTTAAAGTAGG - Intronic
965115524 3:164483035-164483057 CAAAGGGAAAGCTTTAGAGTTGG + Intergenic
965764290 3:172113830-172113852 CAGAGTGAAGACTGTAAAGTGGG - Intronic
966081297 3:176005031-176005053 CAAAGGTATGACCTTCAAATGGG - Intergenic
967676275 3:192302412-192302434 CAAAAGTGAGACTTAAAAGGGGG - Intronic
967903438 3:194481352-194481374 CAAAGGCAACCCTTAAAAGTTGG + Intronic
967918236 3:194595491-194595513 CAAAGGTAAGAGTAAAGAGTTGG - Intronic
971591424 4:28473860-28473882 CTAAGATAAGACTTTAAACTTGG + Intergenic
974865321 4:67573093-67573115 AAAAGGGAAGAATTTAAAGCTGG + Intronic
974980596 4:68952615-68952637 TAAAGGTAAGAGTTTAAAACAGG + Intergenic
975170274 4:71224918-71224940 CAAAATTAGAACTTTAAAGTGGG + Intronic
976410173 4:84704320-84704342 TACAGGTAAAACTTTAAATTTGG - Exonic
976857788 4:89625715-89625737 CAAGATTAAGACTTTAAAGCAGG - Intergenic
977148927 4:93483844-93483866 CAAAGGTCTGACTCTGAAGTTGG - Intronic
977553962 4:98470069-98470091 GAAAGGTAAGATTTTGTAGTTGG - Intergenic
978998494 4:115185820-115185842 CAAGTGTAAAACTTTAAAGATGG - Intergenic
979125531 4:116968181-116968203 CTTAGGTAAGACTTTAGAGTTGG - Intergenic
979140460 4:117166222-117166244 CCCAGGTATGACTTTCAAGTAGG - Intergenic
979399055 4:120225316-120225338 CAAAGTGAAGCCTTTAGAGTAGG - Intergenic
979886919 4:126039584-126039606 CAAAGATAATAATTTAAAATTGG - Intergenic
980480487 4:133380585-133380607 CAAAGATAAGACTTTGAAAAAGG - Intergenic
980496452 4:133591601-133591623 CATAGGCAAGACTATAAAGAAGG - Intergenic
987514181 5:18884529-18884551 CAAATGTAACACTTTGATGTGGG + Intergenic
988262484 5:28906362-28906384 CAAATGTAATACTGCAAAGTTGG - Intergenic
988538915 5:32091638-32091660 CAAAAGTAAGAAATTAATGTTGG + Intronic
988562666 5:32294984-32295006 CCAAGGTCAGACTTTTAATTTGG + Intronic
989788362 5:45359477-45359499 CACAGGTAAGACTCTACTGTGGG - Intronic
991567980 5:68024660-68024682 CAAAGGTAAGAATTGAATTTAGG + Intergenic
992209178 5:74460858-74460880 CCAAGCTTAGACTTTAATGTGGG + Intergenic
992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG + Intronic
993358750 5:86946920-86946942 TAAAGTTTAGACTTTAGAGTTGG - Intergenic
994000831 5:94776983-94777005 CAAATGTAATAATTTACAGTAGG - Intronic
994073462 5:95626384-95626406 CAATGGTAGTACTTAAAAGTAGG + Intergenic
994832807 5:104808253-104808275 CAAAAGCAAGAATTTAAAGTTGG - Intergenic
995279837 5:110321521-110321543 CATAGGTAAAACTTAAAAATAGG - Intronic
995823839 5:116270390-116270412 AAAAGGTAGAACTTTACAGTTGG + Intronic
996072918 5:119155206-119155228 AAATGATAAGACTTAAAAGTTGG - Intronic
998568853 5:143239424-143239446 CAAAGGAAAGAGCTTAAAGTAGG - Intergenic
998888260 5:146717939-146717961 CAATGTGAAGACTTTAAAATAGG - Intronic
999725842 5:154437121-154437143 CAAATGCAAGACTTTGAGGTAGG + Intergenic
1001908792 5:175496629-175496651 CAAATCAAAGACTTTAAAATTGG + Intronic
1002353186 5:178599967-178599989 CAAAGTTAAGACTTAAATATTGG + Intergenic
1004730137 6:18349743-18349765 CACAGGTGAGACTTTGTAGTGGG - Intergenic
1004824229 6:19402784-19402806 CAAAGGGAAGTCTTCCAAGTGGG - Intergenic
1006726374 6:36201879-36201901 CAAAAGGAAGAGTTTAAATTCGG - Intronic
1008695280 6:54028793-54028815 CAAAGGCATGACTGTAAAGAAGG - Intronic
1011171621 6:84511139-84511161 CAAATGAAGGACTTTAAAATTGG - Intergenic
1012410855 6:98955347-98955369 CAAAGTGAAGACTTGAATGTAGG + Intergenic
1014573600 6:123042517-123042539 CAGAGATAAGAGTTTAAATTGGG - Intronic
1014670086 6:124292184-124292206 CAAAGGTCAGTGTGTAAAGTGGG - Intronic
1015222875 6:130825087-130825109 CTTAGGTAGGACTTTAAAGAAGG - Intergenic
1015356168 6:132279617-132279639 CCAAAGTAAGACTTAAAAGAAGG - Intergenic
1016543219 6:145190483-145190505 CAATGGTGTGACCTTAAAGTTGG + Intergenic
1016570075 6:145502118-145502140 TAAAGGTAAGAGTTTGAAATTGG + Intronic
1016715335 6:147220628-147220650 CCAAGGAAAGTCATTAAAGTGGG - Intronic
1016983111 6:149871148-149871170 AAAGGGTCAAACTTTAAAGTTGG - Intergenic
1017027191 6:150191820-150191842 CAAAGGTGAGACTTTAAAAGAGG + Intronic
1017069908 6:150566515-150566537 CAAAAGTAAGATTTTGAACTTGG - Intergenic
1020371060 7:7432455-7432477 CAAAGGTAAGACTTTAAAGTAGG - Exonic
1020741916 7:12030857-12030879 CAAAGGAAAGACAATAAGGTGGG - Intergenic
1021427815 7:20522718-20522740 AAAAAGTAAGTCTTGAAAGTGGG + Intergenic
1022637801 7:32153705-32153727 CAAAGGCAAGATTTTCAAGTGGG + Intronic
1024882465 7:54104149-54104171 CAGAGTTAAGACTTGAAATTAGG + Intergenic
1026366475 7:69653711-69653733 CAAAGGTAACCCTGAAAAGTAGG - Intronic
1027816296 7:82976325-82976347 GGAAGGAAAGAATTTAAAGTAGG - Intronic
1027924186 7:84439218-84439240 CATAGGTAAGAATTTAGAGAGGG + Intronic
1028162857 7:87505879-87505901 AAAAGGTAAGAATTTAAATTGGG - Exonic
1028599603 7:92588051-92588073 GAGGGGTAAGACTTTAAACTGGG - Intronic
1028655724 7:93204425-93204447 CTCAGTTAAAACTTTAAAGTAGG + Intronic
1031056851 7:117001305-117001327 CAAAAGGTAGACTTTAAATTTGG - Intronic
1031110821 7:117606343-117606365 CAAAAGTAAGATTGTAAAGCAGG + Intronic
1031513567 7:122676406-122676428 CAAATGTTTGTCTTTAAAGTTGG + Intronic
1031671894 7:124558131-124558153 CACAGGAAAGAAATTAAAGTAGG + Intergenic
1032572525 7:133015619-133015641 TAAATGAAAGACTTTAAAGAAGG + Intronic
1032897507 7:136267485-136267507 CAAACTAATGACTTTAAAGTTGG - Intergenic
1033124149 7:138692891-138692913 CAAAGGTGAGAGTTGGAAGTCGG + Intronic
1033267453 7:139898235-139898257 CAAAGGTCAGACTTGAGGGTAGG + Intronic
1033853826 7:145532677-145532699 AAAAGATAAAACTATAAAGTTGG + Intergenic
1036974390 8:13394706-13394728 CAAAGCTAAGACTGGAGAGTTGG - Intronic
1039087714 8:33796328-33796350 AAAAGGTAAGATTATAAAGAAGG + Intergenic
1040119972 8:43673024-43673046 CAAAGGGAAGACTGCAAAATGGG + Intergenic
1042439963 8:68813961-68813983 GTAATGTAAGACTTTAGAGTTGG - Intronic
1042576238 8:70222793-70222815 CTAAGATAAGACTTTGAAGGAGG - Intronic
1042581708 8:70286498-70286520 CAAAGATAAAATTTTAAAGGTGG + Intronic
1043705969 8:83351341-83351363 CAAAAATAAAACATTAAAGTGGG + Intergenic
1044194804 8:89362328-89362350 GAAACGTAAGACTCTAAAGGTGG + Intergenic
1045382807 8:101643864-101643886 CAAAGGTGAGACTTCAAAAGTGG - Intronic
1047341213 8:123982154-123982176 CAAAGTTAAGTCTCCAAAGTTGG - Intronic
1048692064 8:136977671-136977693 CAGAGATAAGAATTGAAAGTGGG + Intergenic
1048694888 8:137015040-137015062 CTAATGTAAAAATTTAAAGTTGG - Intergenic
1048920827 8:139228591-139228613 CAAAGGAAAGAATTTCAAGATGG + Intergenic
1051099980 9:13510085-13510107 CAAATGTAACACTTTTAATTTGG - Intergenic
1053621553 9:39824652-39824674 CAAAGGCAAAACTTTAGAGGCGG + Intergenic
1054872037 9:70056320-70056342 TAAAGCTTATACTTTAAAGTTGG - Intronic
1055066319 9:72122721-72122743 AAAAAGAAAGACTGTAAAGTTGG - Intronic
1055522754 9:77098183-77098205 CTAAGGAAAGATTTTAAAGTAGG + Intergenic
1058993970 9:110281455-110281477 CAGAGGTGAAACTATAAAGTCGG + Intergenic
1059031406 9:110701324-110701346 CAAAGGCAAGACATAAATGTTGG + Intronic
1059796832 9:117706705-117706727 GAAAAGGAAGATTTTAAAGTGGG - Intronic
1060061018 9:120459730-120459752 CAAAGCTAAGACTTTGAATGAGG + Intronic
1060089006 9:120726690-120726712 CAAGTGCAAGACTTTGAAGTTGG + Intergenic
1061175464 9:128993399-128993421 CAAAGGTAAGCCTGTAACCTGGG + Exonic
1185760595 X:2687557-2687579 AAGAGGTAACACTTTAAAGGTGG + Intergenic
1187339757 X:18410662-18410684 GAAAGTGAAGACTTTAAAGAAGG - Intergenic
1189403928 X:40700493-40700515 TAAAGAAAAGACTATAAAGTGGG - Intronic
1189601599 X:42632630-42632652 CAGAGGTAAGACATCACAGTGGG + Intergenic
1189759705 X:44308705-44308727 CACAGGACTGACTTTAAAGTTGG + Intronic
1190153234 X:47966177-47966199 CAAAGAAATGACTTAAAAGTTGG + Intronic
1194626518 X:96232323-96232345 CATAGGCCAGACTTTATAGTGGG + Intergenic
1195545761 X:106110578-106110600 AAAAGTTAAGAATTTCAAGTAGG + Intergenic
1196746531 X:119075563-119075585 AAAAGCTAAGAATTTCAAGTAGG + Intergenic
1196950656 X:120873384-120873406 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196951350 X:120878288-120878310 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196951491 X:120929777-120929799 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196952175 X:120934638-120934660 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196952860 X:120939499-120939521 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196953545 X:120944359-120944381 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196954230 X:120949220-120949242 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196954913 X:120954080-120954102 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196955603 X:120958963-120958985 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196956283 X:120963824-120963846 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196956965 X:120968684-120968706 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196957647 X:120973544-120973566 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196958329 X:120978404-120978426 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196959011 X:120983264-120983286 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1198315152 X:135458016-135458038 CACATGTAAAACTATAAAGTTGG - Intergenic