ID: 1020371716

View in Genome Browser
Species Human (GRCh38)
Location 7:7439273-7439295
Sequence ATACATGCCTTGGCAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020371716_1020371722 13 Left 1020371716 7:7439273-7439295 CCAGTTCTTGCCAAGGCATGTAT 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1020371722 7:7439309-7439331 AATCCAAACCTGGAAGGCAATGG 0: 1
1: 0
2: 0
3: 42
4: 315
1020371716_1020371724 19 Left 1020371716 7:7439273-7439295 CCAGTTCTTGCCAAGGCATGTAT 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1020371724 7:7439315-7439337 AACCTGGAAGGCAATGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 227
1020371716_1020371720 7 Left 1020371716 7:7439273-7439295 CCAGTTCTTGCCAAGGCATGTAT 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1020371720 7:7439303-7439325 TCCTTAAATCCAAACCTGGAAGG No data
1020371716_1020371719 3 Left 1020371716 7:7439273-7439295 CCAGTTCTTGCCAAGGCATGTAT 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1020371719 7:7439299-7439321 CCAGTCCTTAAATCCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020371716 Original CRISPR ATACATGCCTTGGCAAGAAC TGG (reversed) Intronic
903762445 1:25708291-25708313 ATAAATGCCATGGCAACATCAGG - Intronic
906292035 1:44625622-44625644 GAACAGGCCTTGGCAAGAGCGGG + Intronic
911073697 1:93852376-93852398 ATACAAGCATTGGCAAGGATTGG + Intergenic
912912064 1:113772132-113772154 TTACATGCCTTGTCAATAAGTGG - Intronic
915211714 1:154314376-154314398 ACAAATGCCATGGCAACAACAGG + Intergenic
916464767 1:165062790-165062812 ATAGATGACTTGGGAAGACCTGG - Intergenic
919313154 1:195937362-195937384 ATACATCCCTTGGCAAGATCTGG + Intergenic
1062771792 10:106946-106968 ACAAATGCCTTGGCAACATCAGG - Intergenic
1064140870 10:12789039-12789061 ATATATTCCTGAGCAAGAACAGG - Intronic
1064994348 10:21283263-21283285 ATAAATGCCATGGCAACAACAGG + Intergenic
1066117401 10:32252894-32252916 ATAGATGCCATGGCAACATCAGG - Intergenic
1066282608 10:33932264-33932286 ATAGATGCCATGGCAACATCAGG + Intergenic
1067044741 10:42979149-42979171 AAAGAAGCCTTGGCAAGGACTGG + Intergenic
1068129250 10:52876934-52876956 ATAAATGCCTAGGCAACCACAGG - Intergenic
1069106010 10:64384334-64384356 ATACATCACATGGCAAGAGCAGG + Intergenic
1069351554 10:67532749-67532771 ATAAATTACTTGGCAAGAACTGG - Intronic
1070575977 10:77679330-77679352 ACAAATGCCTTGGCAACATCGGG + Intergenic
1071391999 10:85184565-85184587 ACAAATGCCTTGGCAACATCAGG - Intergenic
1073281157 10:102355121-102355143 ATACCTGCCTTAGGAAGAAAGGG + Intronic
1073990476 10:109257014-109257036 ATAAATGCCATGGCAACATCAGG - Intergenic
1074059939 10:109955879-109955901 ATACATTCCCTGGCAATAATTGG - Intergenic
1075037167 10:119079665-119079687 ATAAATGCCTTGGAGAGATCGGG + Intronic
1086062011 11:82709364-82709386 ATACATCACATGGCAAGAGCAGG + Intergenic
1095602799 12:44033184-44033206 ACAGATGCCTTGGCAACATCAGG + Intronic
1098137751 12:67420499-67420521 ATAAATGCCATGGCAATGACAGG - Intergenic
1098909638 12:76195826-76195848 ACAGATGCCATGGCAACAACAGG - Intergenic
1103967229 12:124647490-124647512 ATACAGGCAGTTGCAAGAACAGG - Intergenic
1104197557 12:126555499-126555521 ACAGATGCCTTGGCAACATCAGG + Intergenic
1105778188 13:23682044-23682066 ACAAATGCCATGGCAAGATCAGG + Intergenic
1108119644 13:47170754-47170776 TTAAATGCCTTGGCAAGAGGTGG - Intergenic
1108412241 13:50161490-50161512 ATATATGTTTTGGCAAGAATTGG - Intronic
1112227833 13:97558001-97558023 CAACATGCCCTGGCAGGAACTGG - Intergenic
1112255495 13:97826869-97826891 ATAAATGCCATGGCAACATCAGG + Intergenic
1113517974 13:110917632-110917654 ATAAATGCCATGGCAACATCAGG + Intergenic
1114655812 14:24314998-24315020 TTACAAGCTTTGGCAGGAACTGG - Exonic
1115785098 14:36816700-36816722 ATACCAGCCTGGGCAAGAAGGGG - Intronic
1116420754 14:44729011-44729033 ATACAAGCACTGACAAGAACAGG + Intergenic
1118971201 14:70640161-70640183 ATAGATGCCTAGGAAACAACTGG + Intergenic
1119109167 14:71955594-71955616 ATAAATGCCATGGCAACATCAGG - Intronic
1120079174 14:80196141-80196163 AAACTTGCCTTAGTAAGAACTGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123207389 14:106726529-106726551 ACACATGCCATGGCAACATCAGG - Intergenic
1123212414 14:106773524-106773546 ACACATGCCATGGCAACATCAGG - Intergenic
1124106724 15:26745036-26745058 GCACATCCCTTGGCGAGAACAGG + Intronic
1124638250 15:31378587-31378609 CTACATGCTGTGGCTAGAACAGG - Intronic
1126133401 15:45366635-45366657 AAACATGCCTGGGAAAGAAGCGG + Intronic
1131292918 15:91122678-91122700 ATAGATGTCTTGGAAAGTACAGG - Intronic
1132017511 15:98331826-98331848 TTAAAAGCCTTGGCCAGAACAGG - Intergenic
1140447544 16:75043266-75043288 TTACAGGCTTAGGCAAGAACAGG - Intronic
1146291569 17:31611272-31611294 ACAAATGCCATGGCAACAACAGG - Intergenic
1150844249 17:68638997-68639019 ACACATGCCATGGCAACATCAGG + Intergenic
1150906381 17:69342562-69342584 ATAAATGCCATGGCAACATCAGG - Intergenic
1155396576 18:25392710-25392732 ATAGATGCCCTGGAGAGAACTGG - Intergenic
1158250215 18:55479556-55479578 ATACTTGCCTTGTCCAGACCTGG + Intronic
1158863425 18:61615374-61615396 ATAAATGCCATGGCAATATCAGG + Intergenic
1160621474 18:80174171-80174193 ATACAGGGCCTGGAAAGAACAGG - Intronic
1164000187 19:21091218-21091240 ATAAATGCCATGGCAACATCTGG - Intronic
1166584821 19:43936429-43936451 ATAAATGCCATGGCAACACCTGG + Intergenic
926073253 2:9918477-9918499 ATCCTTCCCTTGGCAAGAATAGG + Intronic
926360726 2:12084178-12084200 ACAAATGCCTTGGCAACATCAGG + Intergenic
930047582 2:47186706-47186728 AGAGAAGCCTTGGAAAGAACAGG + Intergenic
937670696 2:124534511-124534533 ATAAATGCCATGGCAACATCTGG - Intronic
938994181 2:136659918-136659940 ATAAGTGCATTGACAAGAACTGG - Intergenic
941628653 2:167859540-167859562 ATCCCTGCCTTGGGAAGAATGGG - Intergenic
942277755 2:174335287-174335309 AAAGATGCCTTTGCAAGAAAAGG + Intronic
943546330 2:189284266-189284288 ATACTTGAGTTTGCAAGAACTGG - Intergenic
945577136 2:211545730-211545752 GTACTTTCCCTGGCAAGAACTGG - Intronic
948094381 2:235321825-235321847 ACAAATGCCATGGCAACAACAGG + Intergenic
948227721 2:236324731-236324753 AAACGTGCCTTGGCGATAACAGG - Exonic
1173668638 20:44781795-44781817 AAACAAGCCTTGGAAGGAACTGG + Intronic
1174509144 20:51037870-51037892 CTACATGCCTTGGCAACCACAGG - Intergenic
1176291693 21:5048941-5048963 ATAAATGCCATGGCAACATCAGG - Intergenic
1179865562 21:44214700-44214722 ATAAATGCCATGGCAACATCAGG + Intergenic
1180152382 21:45956825-45956847 GCACATCCCATGGCAAGAACAGG + Intergenic
1182198552 22:28544804-28544826 ATAAATGCCATGGCAACATCTGG + Intronic
1184896310 22:47409062-47409084 ACACATGCCATGGCAACATCTGG + Intergenic
951297586 3:20957884-20957906 AAACATGCCTTGGAAAGGACAGG - Intergenic
952294248 3:32047488-32047510 ATAAATGCCATGGCAACATCAGG - Intronic
955633340 3:60999002-60999024 ATACATGTCCTGCCAAGAGCTGG - Intronic
957199803 3:77118645-77118667 ATACATGACTTGTCAGGAGCAGG + Intronic
963752831 3:149201012-149201034 CTGCGTGCCTTGGCGAGAACAGG + Intronic
965760484 3:172070077-172070099 ATACATGCCCTGGAAAGAAAAGG - Intronic
967243592 3:187465157-187465179 ATAAATGCCATGGCAACATCAGG + Intergenic
967610510 3:191500312-191500334 ATACATTCCTTGGAAAGATGAGG + Intergenic
972309308 4:37865017-37865039 CTCAATGCCTTGGAAAGAACAGG + Intergenic
974747344 4:66092685-66092707 ATAGATGCCATGGCAATATCAGG + Intergenic
975604298 4:76138151-76138173 ATATAAACATTGGCAAGAACTGG + Intronic
977592740 4:98844616-98844638 ATAAATGCCATGGCAACATCAGG - Intergenic
977741646 4:100491379-100491401 CTCCCTCCCTTGGCAAGAACTGG - Intronic
978395620 4:108276687-108276709 ACACATGCTATGTCAAGAACTGG - Intergenic
978962109 4:114692684-114692706 ATACAGACAGTGGCAAGAACAGG - Intergenic
980588944 4:134857717-134857739 ATACATCCCTTGGCATTACCAGG + Intergenic
982462918 4:155693314-155693336 CGACAGGCCTTGGCAAGAAGTGG - Intronic
984353044 4:178620546-178620568 ATACTAGCCTTGACAAAAACTGG - Intergenic
984412986 4:179419142-179419164 ATATATGCCTTAGCAATTACAGG + Intergenic
984601163 4:181728525-181728547 ATAAATGCCATGGCAACATCAGG - Intergenic
987761329 5:22165857-22165879 ACAAATGCCATGGCAAGATCAGG + Intronic
988781113 5:34522577-34522599 ATAAATGCCATGGCAATGACAGG - Intergenic
991896121 5:71399325-71399347 ACAAATGCCATGGCAAGATCAGG + Intergenic
993370117 5:87082851-87082873 ATACATGCCTAGGCAGAAATAGG + Intergenic
994085915 5:95758860-95758882 ATACCTGCTTTTGGAAGAACTGG + Intronic
996319653 5:122200573-122200595 ACAAATGCATTAGCAAGAACAGG + Intergenic
998235912 5:140398695-140398717 ATACATCCTTAGGCAAAAACAGG - Intergenic
1000178895 5:158787924-158787946 ATACATGCATTAGCAAAACCTGG + Intronic
1000216275 5:159159895-159159917 AGAAATTCCTTGCCAAGAACTGG + Intronic
1000761578 5:165231948-165231970 CTACATGTCTTAGCAAGATCTGG + Intergenic
1000901398 5:166915808-166915830 ATGCATGCCCTGACAAGAAGAGG - Intergenic
1002508953 5:179699935-179699957 ATCCATTACTTGACAAGAACGGG - Intronic
1004536145 6:16504298-16504320 AAGCATGCCTTGTAAAGAACAGG + Intronic
1009492300 6:64306436-64306458 ATTCATGCATTGGTAAGAAGTGG - Intronic
1011671182 6:89684597-89684619 AGACAGGCCTGGGCAAGACCAGG + Intronic
1013657115 6:112257395-112257417 ATAAATGCCATGGCAACATCAGG + Intergenic
1020371716 7:7439273-7439295 ATACATGCCTTGGCAAGAACTGG - Intronic
1023514908 7:40992236-40992258 ATAAATGCCATGGCAATATCTGG - Intergenic
1024136238 7:46412086-46412108 ATTCCTGCCTTGGGAAGAAAAGG + Intergenic
1025849439 7:65233982-65234004 ACAGATGCCATGGCAAGATCTGG + Intergenic
1025905615 7:65782170-65782192 ATAAATGCCATGGCAACATCAGG - Intergenic
1028424413 7:90670624-90670646 ACACATCACTTGGCAAGAGCAGG + Intronic
1032734311 7:134676868-134676890 AAACATCCCTTGGAAAGAGCAGG - Intronic
1033679814 7:143583353-143583375 ATATCTGCCTGGGCAAGAAGTGG - Intergenic
1033692021 7:143746090-143746112 ATATCTGCCTGGGCAAGAAGTGG + Intergenic
1037367988 8:18143267-18143289 ATAGATGCCATGGCAAAACCAGG - Intergenic
1037613957 8:20500462-20500484 ATAAATGCCATGGCAACATCTGG + Intergenic
1044421017 8:91995896-91995918 ATACATGCTTTGAATAGAACTGG - Intronic
1045691400 8:104763490-104763512 ATAAATGCCATGGCAACATCAGG - Intronic
1052989646 9:34511728-34511750 AAACATGGCCTGGAAAGAACAGG - Intronic
1054694468 9:68346141-68346163 ATACATTACTAGGCAAGTACAGG - Intronic
1055331453 9:75188090-75188112 ACAAATGCCATGGCAACAACAGG - Intergenic
1056316972 9:85399587-85399609 ATTCATGCCTTAGGAAGAAGTGG - Intergenic
1057404352 9:94755331-94755353 ATACATGCATTTGCAACCACAGG + Intronic
1062383940 9:136301143-136301165 TTACTTCCCTTTGCAAGAACAGG - Intronic
1185747793 X:2585528-2585550 ATCCATGACATGGTAAGAACAGG + Intergenic
1185817277 X:3168014-3168036 ACACATGCCATGGCAACATCGGG - Intergenic
1187179652 X:16931950-16931972 ATAAATGCCATGGCAACATCTGG + Intergenic
1187413074 X:19067971-19067993 ATACAAGCATTGTCAAGAATGGG + Intronic
1188714752 X:33448122-33448144 ATACATGCATTGGAACTAACTGG + Intergenic
1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG + Intergenic
1192888355 X:75361936-75361958 ATAAATGCCATGGCAACACCAGG + Intergenic
1195117110 X:101710482-101710504 ATAAATGCCGTGGCAACATCAGG + Intergenic
1198714730 X:139544969-139544991 ATCCATGCCTCAGCATGAACAGG + Intronic
1200807674 Y:7448937-7448959 AAACATGCTTTGTCAAGAACAGG + Intergenic